Báo cáo y học: " Lack of replication of genetic predictors for the rheumatoid arthritis response to anti-TNF treatments: a prospective case-only study" potx
Báo cáo y học: " Lack of replication of genetic predictors for the rheumatoid arthritis response to anti-TNF treatments: a prospective case-only study" potx
... acquisition of clinical data and participated in the analysisand interpretation of results. AG participated in the design of the study andin the coordination of acquisition of clinical data and collection ... for the rheumatoid arthritis response to anti-TNF treatments: a prospective case-only study. Arthritis Research & Therapy 2010 12:R72.Submit your next manuscript to BioMed Centraland take ... LB,van Riel PL: Development and validation of the European LeagueAgainst Rheumatism response criteria for rheumatoid arthritis. Comparison with the preliminary American College of Rheumatologyand...
- 6
- 280
- 0
Báo cáo y học: "Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis" pps
... relations can be fused into one using the Laplace transform. Mathematical transformations of ECG data The 3DMP ECG analysis employs six mathematical transformations. All these transformations ... already scheduled for coronary angiography for any indication and had no history of a coronary revascularization procedure prior to the scheduled angiography. Forty-four patients had a history ... hemodynamically relevant coronary stenosis as diagnosed with coronary angiography were calculated as well as odds ratios for the 3DMP severity score and coronary artery disease risk factors....
- 15
- 456
- 0
Báo cáo y học: " Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis after coronary revascularization" doc
... Harris RA, et al. The role of coronary angiography and coronary revascularization before noncardiac vascular surgery. JAMA. 1995; 273: 1919-1925. 8. Scanlon PJ, Faxon DP, Audet AM, et al. ACC/AHA ... hemodynamically relevant CAD. Methods: A convenience sample of 172 patients with a history of coronary revascularization scheduled for coronary angiography was evaluated with 3DMP before coronary ... computer-based, mathematically derived analysis of resting two-lead ECG data provides detection of hemodynamically relevant CAD in patients with a history of coronary revascularization with...
- 12
- 418
- 0
Báo cáo y học: "Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia" ppt
... Hematology, University of Perugia, Perugia, Italy). The forward and backward primers were: 5’-CGGGATCCATCGAAGGTCGTGAAGATTCGATGGACAT-3’, and 5’-CGCGCGACCGAGCGGAA GCTTCTATTTTCTTAAAGAGAC-3’. Underlined ... protein. The purified protein was dialysed against phosphate-buffered saline (PBS) overnight at 4°C and stored at -80°C before analyzed by SDS-PAGE and quantitated by using the BCA Protein Assay ... Immunohistochemical staining for the cases with NPM1 mutations Ten AML samples had been confirmed to bear NPM-mA by direct sequencing (data not shown). To validate the mAbs against NPM-mA as a diagnostic...
- 6
- 431
- 0
Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx
... cases of duodenal solitary Peutz-Jegherstype hamartomatous polyp. Case 1 was a hamartoma-tous polyp with a focus of well-differentiated adenocar-cinoma, and Case 2 was a hamartomatous polyp ... KA analyzed and interpreted the patient data. AT, NF,KS, AT, MT and HI analyzed endoscopic data. YS, HT, TK, CT, YA, AN and SMperformed the histological examination of the organs. YS, MI and ... nadvanced age simil ar to previous reports, but they differin the malignant alteration of a hamartomatous polypand concomitant other cancers. Patients with duodenalPeutz-Jeghers type hamartomatous...
- 4
- 458
- 0
Báo cáo y học: "Serum cartilage oligomeric matrix protein (COMP) decreases in rheumatoid arthritis patients treated with infliximab or etanercept" pot
... Introduction Rheumatoid arthritis (RA) is a chronic condition, which leads to varying degrees of functional impairment and disability. Inearly stages, symptoms reflecting the inflammatory processoften ... or animals.Alternative or complementary tools to assess progression of tissue damage should therefore facilitate the evaluation of treatments with the potential to modify structural jointdamage. ... (r values >0.9 inRA samples) (T Saxne and D Heinegård, unpublished).Samples obtained at baseline and after 3 and 6 months of therapy if available were analysed.Statistical analysesComparisons...
- 5
- 486
- 0
Báo cáo y học: "Gastrin-releasing peptide, substance P and cytokines in rheumatoid arthritis Paul G Green" pps
... and anti-inflammatory effects inanimal models of inflammatory diseases. An analysis of cytokineand neuropeptide content of synovial fluid from patients with rheumatoid arthritis has revealed a ... and substance P (SP) with inflammatory cytokines.It is well known that proinflammatory cytokines have a fundamental role in the development and maintenance of RAand other inflammatory diseases. ... substance P and cytokines in rheumatoid arthritis Paul G GreenDepartment of Oral and Maxillofacial Surgery, University of California San Francisco, San Francisco, CA, USACorresponding author: Paul...
- 3
- 296
- 0
Báo cáo y học: "Inflammation, carotid intima-media thickness and atherosclerosis in rheumatoid arthritis" doc
... involves the assessment of vasodilatoryresponses: these responses are thought to reflect endothelialfunction alterations at the early stages of atherosclerosis. LikecIMT, endothelial dysfunction ... dysfunction is a predictor of future cardio-vascular disease in the general population [5], is present from the early stages of RA, and has also been interpreted asindicative of accelerated atherosclerosis ... Page 2 of 2(page number not for citation purposes) Arthritis Research & Therapy Vol 10 No 1 Veldhuijzen van Zanten and KitasAnother noninvasive technique used as a surrogate for atherosclerosis...
- 2
- 250
- 0
Báo cáo y học: "Candidate autoantigens identified by mass spectrometry in early rheumatoid arthritis are chaperones and citrullinated glycolytic enzyme" pot
... Identification of citrullinatedalpha-enolase as a candidate autoantigen in rheumatoid arthritis. Arthritis Res Ther 2005, 7:R1421-R1429.11. Suzuki A, Yamada R, Ohtake-Yamanaka M, Okazaki Y, Sawada ... 65:1219-1222.53. Sawada T, Hashimoto S, Yamada R, Suzuki A, Sato W, Takizawa Y, Nagashima M, Inoue T, Yamamoto K: Identification of citrulli-nated p53 as novel autoantigen in rheumatoid arthritis [abstract]. ... predict the severity of the diseaseand to choose the appropriate therapy early. The autoimmune response appears early, often prior to the apparition of clinicalsymptoms, and leads to the production...
- 14
- 381
- 0
Báo cáo y học: "Hypoxia upregulates angiogenesis and synovial cell migration in rheumatoid arthritis" docx
... 321MMP-1 GGAGATCATCGGGACAACTC ACCGGACTTCATATGTCG 529MMP-2 CAAGTGGTCCGTGTGAAGTATG CGTCATCGTAGTTGGCTGTG 496MMP-3 GACAAAGGATACAACAGGGACC TATCAGAAATGGCTGCATCG 575MMP-8 GAAGCCGGAAGGAGGAGAC GTCTGTGGCCTTCTCTC ... CAAGGATGGGAAGTACTGGCG TCAACTCACTCCGGGAACTC 464MMP-13 GATACGTTCTTACAGAAG GACAAATCATCTTCATCACC 496MT1-MMP GTCTTCAAGGAGCGCTGGTTCTG TAGCCCGGTTCTACCTTCAG 488TIMP-1 CTTGCTGCTCTACCTCCACC CTGCATTCACATTTGTTGTGC ... collagenase expression by rheumatoid arthritis synovial cellsHypoxia modulates collagenase expression by rheumatoid arthritis synovial cells. Rheumatoid arthritis synovial cells were exposed to...
- 11
- 390
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyentài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ