báo cáo khoa học: " Arabidopsis thaliana outer ovule integument morphogenesis: Ectopic expression of KNAT1 reveals a compensation mechanism" docx

... expression. (A) Abaxial (dark blue) and adaxial (light blue) domains of the outer integ-ument. (B) Abaxial and adaxial domains of lateral organs of the shoot apical meristem (colour code as in (A) ). ... AccessResearch article Arabidopsis thaliana outer ovule integument morphogenesis: Ectopic expression of KNAT1 reveals a compensation mechanismElisabeth Truernit*1,2 and Jim Haseloff1Address: ... was not a general feature of KNAT1 over- expression. Cell areas were measured in the abaxial andadaxial layers of the epidermis of mature petals (n of cells≥ 22 per petal, 6 petals of 3 plants...

Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt

... Okamuro JK, Caster B, Villarroel R, Van Montagu M& Jofuku KD (1997) The AP2 domain of APETALA2deﬁnes a large new family of DNA binding proteins in Arabidopsis. Proc Natl Acad Sci USA 94, 7076–7081.34 ... M,Schmulling T & Heyl A (2008) Toward an interactionmap of the two-component signaling pathway of Arabidopsis thaliana. J Proteome Res 7, 3649–3660.43 Sparkes IA, Runions J, Kearns A & Hawes C ... simpliﬁedmethod for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735–743.39 Minet M, Dufour ME & Lacroute F (1992) Comple-mentation of Saccharomyces cerevisiae auxotrophicmutants...

Báo cáo khoa học: Arabidopsis thaliana CYP77A4 is the ﬁrst cytochrome P450 able to catalyze the epoxidation of free fatty acids in plants potx

... protein (512 amino acids) has a calcu-lated mass of 58 134 Da and a pI of 8.71. Enzymaticcharacterization of CYP7 7A4 was carried out employ-ing microsomes from the yeast strain WAT11 trans-formed ... sequence of CYP7 7A4 (AT5g04660) was clonedby PCR from a DNA library of Arabidopsis ecotypeColumbia-0. Primers 5¢-CCCCAGATCTATGTTTCCTCTAATCTC-3¢ and 5¢-GGGGGGTACCCTAAATCCTTGGTTTG-3¢ were used as ... physi-ological role of CYP7 7A4 . This lack of data couldexplain the small amount of information availabletoday concerning the ability of plant enzymes to gener-ate epoxides of fatty acids, despite...

Báo cáo khoa học: Nanoparticles can induce changes in the intracellular metabolism of lipids without compromising cellular viability docx

... Shvedova AA, Castranova V, Kisin ER, Schwegler-Berry D, Murray AR, Gandelsman VZ, Maynard A &Baron P (2003) Exposure to carbon nanotube material:assessment of nanotube cytotoxicity using human ... (Nepean, Canada); Alamar bluereagent from Biosource (Montreal, Canada); paraformal-dehyde (PFA) from BDH Laboratories (Poole, UK);glia-speciﬁc rabbit GFAP antibody (Z0334) from DokoCytomation ... tissues[25,26]. Hypoxia and hypoxia-related signaling havebeen associated with major pathologies, such as car-diovascular disease, stroke and cancer [27]. The sig-naling for hypoxia was of interest...

Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx

... Aziz MH, Reagan-Shaw SR, Nihal M,Mukhtar H & Ahmad N (2004) Sanguinarine causes cellcycle blockade and apoptosis of human prostate carci-noma cells via modulation of cyclin kinase inhibitor-cyclin-cyclin-dependent ... from the plantSanguinaria canadensis, has been shown to have anti-microbial, anti-inﬂammatory, antioxidant, and anti-cancer activities [18–27]. It was reported to inhibitproliferation of different ... The alkaloid sanguinarine is effectiveagainst multidrug resistance in human cervical cells viabimodal cell death. Biochem Pharmacol 63, 1415–1421.24 Adhami VM, Aziz MH, Mukhtar H & Ahmad...

Báo cáo khoa học: The chromosomal protein HMGN2 mediates lipopolysaccharide-induced expression of b-defensins in A549 cells potx

... 5¢-AGCTTGATCTGCGAGGTTGTCTGCTATCTCTTGA ATAGCAGACAACCTCGCAGAG-3¢;HMGN2-shRNA-2: sense, 5¢-GATCCA AATGGAGATGCCAAAACATTCAAGAGATGTTTTGGCATCTCCATTTTCA-3¢;antisense, 5¢-AGCTTGAAAATGGAGATGCCAAAACATCTCTTGAATGTTTTGGCATCTCCATTTG-3¢).Additional ... 5¢-AGCTTT GAAAACGTATATGATACCAACAGTAATCTCTTGAATTACTGTTGGTATCATATACGGG-3¢; negative shRNA: sense, 5¢-GATCCGACTTCATAAGGCGACTGCT TCAAGACGGCATGCGCCTTATGAAGTCTTTTTTGTCGACA-3¢; anti-sense, 5¢-AGCTTAGTTCGACAAAAAAGACTTCTTCATAAGGCGCATGCCGTCTTGAAGCACGCCTTATGAAGT-3¢). ... 5¢-AGCTTAGTTCGACAAAAAAGACTTCTTCATAAGGCGCATGCCGTCTTGAAGCACGCCTTATGAAGT-3¢). The complete HMGN2 cDNA was ampliﬁed fromthe total RNA of A5 49 cells by RT-PCR with the primers5¢-CACCATGGCGGAAGGCGGAGCGGC-3¢...

Báo cáo khoa học: Bile acids increase hepatitis B virus gene expression and inhibit interferon-a activity pot

... 5¢-CAGTTAACAAGCATTCAGCCAAC-3¢; SHP: forward primer: 5¢-AGCTATGTGCACCTCATCGCACCTGC-3¢, reverse primer: 5¢-CAAGCAGGCTGGTCGGAATGGACTTG-3¢; and b-actin: forward primer: 5¢-GACTACCTCATGAAGATC-3¢, ... reverse primer: 5¢-ACGGTGGTCTCCATGCGACG-3¢; HBV core: forwardprimer: 5¢-ATGCAACTTTTTCACCTCTGC-3¢, reverseprimer: 5¢-CTGAAGGAAAGAAGTCAGAAG-3¢; FXRa:forward primer: 5¢-GCCTGTAACAAAGAAGCCCC-3¢,reverse ... usingan enhanced chemiluminescence system (Amersham Phar-macia, Piscataway, NJ, USA).Statistical analysisStatistical analyses were conducted using unpairedor paired t-tests as appropriate. All...

báo cáo khoa học: "Emergency adrenalectomy due to acute heart failure secondary to complicated pheochromocytoma: a case report" docx

... Goodperioperative anesthesia management and a laparotomy-based surgical approach - d ue to the patient’ sunstablecondition - enabled tumor removal and, within a fewdays, complete reversal of clinical ... presentationThe patient was a 31-year-old male, with no knowndrug allergies. Pulmonary emphysema and an esophagealfistula had been diagnosed 7 years earlier. The patienthad a recently diagnosed ... include meaureme nts of urinary and plasma cate-cholamines, urinary metanephrines (normetanephrinand metanephrine), and urinary vanillylmandelic acid(VMA); these tests have a sensitivity of over...

báo cáo khoa học: "Primary testicular necrotizing vasculitis clinically presented as neoplasm of the testicle: a case report" ppt

... with an unusual presentation simulating a testicular neoplasm.Case presentation A 25-year-old Caucasian m an went to a general practi-tioner because of right testicular swelling and was trea-ted ... testicle wasenlarged and painful on palpation, and the skin of theright hemiscrotal region was red and warm. Painincreased gradually and worsened slightly with time, butthis type of pain was not ... Pall AA: Isolated testicular vasculitismimicking a testicular neoplasm. J Clin Pathol 1994, 47:1121-1123.11. Atis G, Memis OF, Güngör HS, Arikan O, Saglican Y, Caskurlu T: Testicularpolyarteritis...

Báo cáo khoa học: " Late treatment with imatinib mesylate ameliorates radiation-induced lung fibrosis in a mouse model" docx

... the survival data we also analyzed the animals'clinical status. We found that imatinib treatment in bothearly and late treatment arms also attenuated radiation-related clinical adverse ... H, Nakagawa K, Nakamura N, Koyanagi H, Tago M, IgakiH, Shiraishi K, Sasano N, Ohtomo K: Exceptionally high incidence of symptomatic grade 2-5 radiation pneumonitis after stere-otactic radiation ... later fibrogenesis phase was accompanied by a strong second onset of leukocyte infiltration that beganseveral weeks after irradiation and reached a peak atapproximately 20 weeks post irradiation.At...

Xem thêm