Báo cáo khoa học: " Correlation between HIV viral load and aminotransferases as liver damage markers in HIV infected naive patients: a concordance cross-sectional study" pdf

... which HIV causeshepatic damage are still unknown. Our aim was to determine the correlation between HIV viral load, and serum levels of aspartate aminotransferase (AST) and alanine aminotransferase ... CentralPage 1 of 4(page number not for citation purposes)Virology JournalOpen AccessShort report Correlation between HIV viral load and aminotransferases as liver damage markers in HIV infected ... 292,905Scatter plot of HIV viral load and ASTFigure 1Scatter plot of HIV viral load and AST. There is a signif-icant moderately strong, positive correlation between HIV viral load and AST (r = 0.439,...

Báo cáo khoa học: Interaction between catalytically inactive calpain and calpastatin Evidence for its occurrence in stimulated cells docx

... observations indicating that calpain and calpast-atin can associate in a 1 : 1 molar ratio, regardless ofthe presence of Ca2+(unpublished work). In addition to Ca2+ and calpastatin, a number ... thesestructural changes must precede the calpain activestate. As shown in Fig. 3, when calpain was exposed toincreasing concentrations of recombinant calpastatinRNCAST104, there was a much greater increase ... stainedwith propidium iodide. The arrows indicate the perinuclear calpasta-tin aggregates. C ¼ control; Ar. ¼ arachidonate.Calpain–calpastatin interaction in stimulated cells M. Averna et al.1664...

Báo cáo khoa học: Correlation between conformational stability of the ternary enzyme–substrate complex and domain closure of 3-phosphoglycerate kinase potx

... Desmadril M, Minard P, Ballery N, Gaillard-Miran S,Hall L & Yon JM (1991) Conformational changes in yeast phosphoglycerate kinase upon ligand binding:Substrate-assisted domain–domain cooperativity ... 3-phosphoglycerate kinaseAndrea Varga1, Bea´ta Flachner1,E´va Gra´czer1, Szabolcs Osva´th2, Andrea N. Szila´gyi1 and Ma´ria Vas11 Institute of Enzymology, Biological Research Center, ... X-Ray Scattering. Akade´miai Kiado´, Budapest.34 Sinev MA, Razgulyaev OI, Vas M, Timchenko AA &Ptitsyn OB (1989) Correlation between enzyme activity and hinge-bending domain displacement...

Báo cáo khoa học: "Correlation between ROUGE and Human Evaluation of Extractive Meeting Summaries" pptx

... summarization evaluation can be broadly clas-siﬁed into two categories (Jones and Galliers, 1996): in- trinsic and extrinsic evaluation. Intrinsic evaluation, such as relative utility based ... meeting characteristics, such as disﬂuencies and speaker information, especially when evaluatingsystem-generated summaries.1 IntroductionMeeting summarization has drawn an increasing atten-tion ... summarization. In ACL Workshop on Intrinsic and Extrinsic Evaluation Measures for MT and/ or Summariza-tion.X. Zhu and G. Penn. 2006. Comparing the roles of tex-tual, acoustic and spoken-language...

Báo cáo khoa học: Correlation between functional and structural changes of reduced and oxidized trout hemoglobins I and IV at different pHs doc

... recording were accumu-lated for each sample.Peroxidase activity assayThe assay for peroxidase activity was performed as reportedby Everse et al. [6] using guaiacol as substrate. Fiftymillimolar ... pHdecrease, remaining in the R conformational state also atlow pH. On the contrary, the pH decrease induces similarstructural changes, characteristics of ligand dissociation and R ﬁ T transition, ... and a decreased intensity in thispeak was measured in both iron(II)- (Fig. 2A) and met-HbIV (Fig. 2C), as a consequence of pH decrease, althoughthe superimposition of two different bands in...

báo cáo khoa học:" Correlation between adherence rates measured by MEMS and self-reported questionnaires: a meta-analysis" pps

... methods, and study durations that wereinvolved in the original trials. Publication bias wasexamined using the Begg-adjusted rank correlation testbased on Kendall’ s score and Egger regression asym-metric ... as measuring adher-ence were in HIV and few were in hypertension, schizo-phrenia and diabetes.ConclusionBased on the pooled estimate using meta-analysis, atleast moderate correlation was found ... and Anticoagulation-related Outcomes Among Patients Taking Warfarin.Journal of General Internal Medicine 2006, 21(8):841-846.31. Reinhard MJ, Hinkin CH, Barclay TR, Levine AJ, Marion S, Castellon SA,Longshore...

Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf

... subline was obtained by sequential exposure ofcells to increasing concentrations of doxorubicin and wasmaintained in the presence of 0.5 lm doxorubicin. A totalof 2008 parental cells and their ... dyesentering the cells remain free in the cytoplasm and arepassively bound to various intracellular sites. Likelysites are the intracellular membranes because they arehydrophobic and negatively charged. ... above was simi-lar to that of NBD-Cl (data not shown). Probenecid,another inhibitor of MRP transporters [29], increasedrhodamine uptake (Table 2). Vanadate, a nonspeciﬁcinhibitor of ATPase activity,...

Báo cáo khoa học: Interactions between coenzyme B12 analogs and adenosylcobalamin-dependent glutamate mutase from Clostridium tetanomorphum pot

... to assay glutamatemutase activity [22]. The assay was made irreversible bycoupling the formation of 3-methylaspartate to the pro-duction of mesaconate through deamination by methylas-partase. ... reaction was initiated by addingl-glutamate and incubating at room temperature for15 min. The formation of mesaconate was then analyzedby reverse-phase HPLC on a C18column (4.6 · 250 mm) as ... UV–visible absorption spectra of theMeCbi-glutamate mutase, AdoCbi-glutamate mutase and AdoCbi-GDP-glutamate mutase complexes weremeasured. A red shift was observed in the spectra ofprotein-bound...

Báo cáo khoa học: "Mapping between Compositional Semantic Representations and Lexical Semantic Resources: Towards Accurate Deep Semantic Parsing" docx

... grammars with a semantic interface forscalable machine translation. In Proceedings of the10th Machine Translation Summit, pages 165 – 172,Phuket, Thailand.Dan Flickinger. 2002. On building ... Resources: Towards Accurate Deep Semantic ParsingSergio Roa†‡, Valia Kordoni† and Yi Zhang†Dept. of Computational Linguistics, Saarland University, Germany†German Research Center for Artiﬁcial Intelligence ... so-called shal-low semantic parsers build basic predicate-argumentstructures or label semantic roles that reveal the par-tial meaning of sentences (Carreras and M`arquez,2005). Manually annotated...

Báo cáo sinh học: "Correlation between LTR point mutations and proviral load levels among Human T cell Lymphotropic Virus type 1 (HTLV-1) asymptomatic carriers" potx

... clinical isolates. PCR was performed using the primers HFL1 (39) (5' CCCAAGCTTGACAATGACCATGAGC 3') and HFL2 (782) (5'CCCGAATTCCAACTGTGTACTAAATTTC 3') and in conditions as ... Sugimoto M, Nakashima H, Watanabe S, Uyama E, Tanaka F, Ando M, Araki S, Kawasaki S: T-lymphocyte alveolitis in HTLV-I-associated myelopathy. Lancet 1987,2(8569):1220. 7. Kawai H, Saito M, Takagi M, ... for each clinical sample was calculated by defining the point at which the fluorescence exceeded a threshold limit. Each sample was assayed in duplicate, and the mean of the two values was considered...

Xem thêm