báo cáo khoa học: " SolEST database: a "one-stop shop" approach to the study of Solanaceae transcriptomes" potx
báo cáo khoa học: " SolEST database: a "one-stop shop" approach to the study of Solanaceae transcriptomes" potx
... AccessDatabase SolEST database: a "one-stop shop" approach to the study of Solanaceae transcriptomesNunzio D'Agostino, Alessandra Traini, Luigi Frusciante and Maria Luisa Chiusano*Address: ... RK, Bouzayen M,Shibata D, Tabata S, Granell A, Botella MA, Giuliano G, Frusciante L,Causse M, Zamir D: The Tomato Sequencing Project, the FirstCornerstone of the International Solanaceae Project ... aligned only along potato BACs, suggestingthat the potato sequencing project, although started later,is providing a complementary contribution to that of tomato.Tomato as well as potato BACs...
- 16
- 298
- 0
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
... A fixed point approach to the stability of an equation of the square spiral,” Banach Journal of Mathematical Analysis, vol. 1, no. 2, pp. 148–153, 2007.14 S M. Jung and J. M. Rassias, “Stability ... Proceedings of the National Academy of Sciences of the United States of America, vol. 27, pp. 222–224, 1941.3 T. Aoki, “On the stability of the linear transformation in Banach spaces,” Journal of the ... Nonlinear Differential Equations and Their Applications, Birkh¨auser, Boston, Mass, USA, 1998.8 S M. Jung, Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, HadronicPress,...
- 7
- 257
- 0
Báo cáo hóa học: " Research Article A Fixed Point Approach to the Stability of a Volterra Integral Equation" pptx
... Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis,Hadronic Press, Palm Harbor, Fla, USA, 2001.[10] Th. M. Rassias, “On the stability of functional equations and a problem ... stability of functional equations in several variables,” AequationesMathematicae, vol. 50, no. 1-2, pp. 143–190, 1995.[5] P. G˘avrut a, A generalization of the Hyers-Ulam-Rassias stability of approximately ... Hyers-Ulam-Rassias stability and the Hyers-Ulam stability of the Volterra integral equation(1.2).2. Hyers-Ulam-Rassias stabilityRecently, C˘adariu and Radu [12] applied the fixed point method to...
- 9
- 278
- 0
Báo cáo khoa học: "Distributed Listening: A Parallel Processing Approach to Automatic Speech Recognition" pot
... uses an N-gram of size 1, also known as a unigram. The grammar consists of known utterances that can be made by the user. The unigram grammar is stored in a phrase database. The grammar is ... is organized according to individual words and phrases. Each phrase is placed in a table. The phrases are broken down into their individual words and placed in another table. The table of words ... research is to take a unique approach in order to enhance the success of the traditional approaches to speech recognition. The approach of Distributed Listen-ing directly mimics people. The...
- 4
- 252
- 0
Báo cáo sinh học: " Research Article A Gaussian Mixture Approach to Blind Equalization of Block-Oriented Wireless Communications Frederic Lehmann (EURASIP Member)" doc
... final ISI state of the current data burst to a known value. At the same time, thisalso sets the initial ISI state of the next data burst to the same known value. Since blind equalization is of ... Bayesian equalization algorithm basedon a Gaussian mixture parameterization of the a posteriori probability density function (pdf) of the transmitted data and the channel. The performances of the proposed ... equalization has attracted considerable attention in the communication literature over the last three decades. The main advantage of blind transmissions is that they avoid the need for the transmission...
- 10
- 267
- 0
Báo cáo hóa học: " Research Article A Fixed Point Approach to the Fuzzy Stability of an Additive-Quadratic-Cubic Functional Equation" pdf
... Journal of MathematicalAnalysis and Applications, vol. 251, no. 1, pp. 264–284, 2000.64 Th. M. Rassias, “On the stability of functional equations and a problem of Ulam,” Acta ApplicandaeMathematicae, ... Point Theory and Applications56 J. M. Rassias and M. J. Rassias, “On the Ulam stability of Jensen and Jensen type mappings onrestricted domains,” Journal of Mathematical Analysis and Applications, ... Banach spaces,” Journal of the MathematicalSociety of Japan, vol. 2, pp. 64–66, 1950.16 Th. M. Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the AmericanMathematical...
- 24
- 306
- 0
Báo cáo hóa học: " Research Article A Unified Approach to BER Analysis of Synchronous Downlink CDMA Systems with Random " doc
... This analysis presents a unified approach as Nakagami-m fading is a general fading distribution that includes the Rayleigh, the one-sided Gaussian, the Nakagami-q, and the Rice distributions as ... that data has a normal distribution with unspecified mean and varianceagainst the alternative data that does not have a normal dis-tribution. This test compares the empirical distribution of the ... uncon-ditional pdfs of MAI and MAI plus noise in Nakagami-m,Rayleigh, one-sided Gaussian, Nakagami-q, and Rician fad-ing environments are derived. In this analysis, unlike [6], the random behavior of the...
- 12
- 360
- 0
Báo cáo khoa học: " Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" ppsx
... apical staining of this marker wasapparent in distinct areas of 3-D Huh7 aggregates (Fig. 3).Taken together, these data demonstrate that the expres-sion and distribution of cell adhesion and TJ ... particularly the interaction,organization, and stoichiometry of HCV receptors and TJproteins. Additional analyses to determine the extent of differentiation and polarization of 3-D Huh7 aggregates ... rather than just the cellsat the periphery, demonstrating that HCV can spreadthroughout the aggregates. Importantly, Fig. 4D and 4Eillustrate that aggregates allowed to differentiate in the RWV...
- 8
- 326
- 0
Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf
... retinoic-acid-receptor-related orphan receptor alpha-4. Biochem J2003, 369:583-591.34. Kamiya A, Kinoshita T, Ito Y, Matsui T, Morikawa Y, Senba E,Nakashima K, Taga T, Yoshida K, Kishimoto T, Miyajima A: ... apical staining of this marker wasapparent in distinct areas of 3-D Huh7 aggregates (Fig. 3).Taken together, these data demonstrate that the expres-sion and distribution of cell adhesion and TJ ... transport in choroid plexus. J Biol Chem1987, 262:13907-13915.37. Nakata K, Tanaka Y, Nakano T, Adachi T, Tanaka H, Kaminuma T,Ishikawa T: Nuclear receptor-mediated transcriptional regu-lation...
- 8
- 642
- 0
Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx
... CAGCAACGCAAGCTTB-g2 CAGCAACGCAAGCTB-g4 CAGCAACGCAAG A- b15 AGAGATTTTCCACAT A- b17 CTAGAGATTTTCCACAT A- b19 TGCTAGAGATTTTCCACATD TGACAAGGATGGCTGGTGGGACTTAGCGTAE TACGCTAAGTCCCACCAGCCATCCTTGTCAF CCAGTGATCACATACGCTTTGCTAGGACATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAGTGCCACGTTGTATGCCCACGTTGACCGG ... GACGCTGCCGAATTCTGGCTTGCTAGGACATCTTTGCCCACGTTGACCCGX2 CGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTCX3 GACGTCATAGACGATTACATTGCTAGGACATGCTGTCTAGAGACTATCGCX4 GCGATAGTCTCTAGACAGCATGTCCTAGCAAGCCAGAATTCGGCAGCGTCX1half ... 1.Oligoname Sequences (5¢ -to3 ¢) A GGCTGCAGGTCGACB CAGCAACGCAAGCTTGC GTCGACCTGCAGCCCAAGCTTGCGTTGCTG A- flap ATGTGGAAAATCTCTAGCAGGCTGCAGGTCGACB-flap CAGCAACGCAAGCTTGATGTGGAAAATCTCTAGCAB-g1 CAGCAACGCAAGCTTB-g2...
- 14
- 433
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM