báo cáo khoa học: " A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discs" pot
báo cáo khoa học: " A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discs" pot
... BiologyOpen AccessMethodology article A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discsKlaas Bouwmeester and Francine Govers*Address: ... (Brassica oleraceavar. gemmifera) and rutabaga (swedes) (Brassica napus var.napobrassica) [6,7]. P. brassicae is mostly associated withpost-harvest damage that limits the marketability of cab-bage ... Belhaj and F. Mauch, personal communication; [16]). This studyaimed at establishing a fast, simple and convenient system for production and isolation of P. brassicae zoospores. Wefirst compared...
- 7
- 340
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-CACAACGCCACCAACCATCAGACCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab-start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATTCCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTACACAACGCCACCAACCATCAG-3¢.The PCR solution was prepared ... and using the following primers: Aba, 5¢-ATGGACGCTGAATTCCGTCACGACTCTGGTTACGAAGTTCACCACCAGAAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCTGGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAGGGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGACCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab-start, ... enzyme, and contained Aba, Abb and Abcat40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP,dGTP and dTTP. The product was separated from...
- 16
- 691
- 0
báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx
... the potential of naturalistic pacing, it still featuressomewhat unnatural control methods (hand, foot, and tongue motor imagery), as well as variable accuracy and high computational demand. ... C3, and calculated bandpower on C3 for the referenced signal.To determine the optimum spatial location and frequencyband for discrimination, we conducted a feature analysisby calculating Bhattacharyya ... TAK also assisted with data collection, per-formed the data analysis, and drafted and revised themanuscript. OB developed the Matlab-based software sys-tem for EEG data acquisition and processing...
- 16
- 489
- 0
báo cáo khoa học: "A novel method of cultivating cardiac myocytes in agarose microchamber chips for studying cell synchronization" ppt
... number not for citation purposes) (A) : Schematic drawing of the on- chip agar cultivation assayFigure 1 (A) : Schematic drawing of the on- chip agar cultivation assay. (B): Optical micrograph of 24-h ... beam wasmoved parallel to the chip surface, a portion of agararound the focal spot of laser melted and diffused intowater; (d) after the heated spot had been moved, a chan-nel was created at ... melt-ing of agar by laser occurred as follows: (a) the 1064-nminfrared laser beam was focused on the agar layer on theglass slide; (b) the agar at the focal point and on the lightpathway started...
- 4
- 229
- 0
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot
... protein database (release 48.8) with fixedcarbamidomethyl modification of cysteine residues, vari-able oxidation of methionine and variable deamidation of asparagine and glutamine. Parent and fragment ... and activated in situ by limited trypsin treatment at conflu-ent cell stage. Conditioned media of meprin activated and non-activated cells were concentrated with ultrafil-tration and then separated ... S, Navarro JD, Amanchy R, Kristiansen TZ,Jonnalagadda CK, Surendranath V, Niranjan V,Muthusamy B, Gandhi TK, Gronborg M et al. (2003)Development of human protein reference database asan initial...
- 20
- 506
- 0
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
... Annual Meeting of the Association for Computational Linguistics, pages 188-195. Ferreira da Silva, J. and G. Pereira Lopes (1999). A local maxima method and a fair dispersion normalization for ... C-Value and NC-Value Method. International Journal on Digital Libraries 3(2):115-130. Gil, A. and G. Dias. (200 3a) . Efficient Mining of Textual Associations. International Conference on Natural ... 605–613,Ann Arbor, June 2005.c2005 Association for Computational Linguistics A Nonparametric Method for Extraction of Candidate Phrasal Terms Paul Deane Center for Assessment, Design and Scoring...
- 9
- 507
- 1
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... band (bp)Human genesFDX1 P553 GTGATTCTCTGCTAGATGTTG Exon 2 257P554 GGCACTCGAACAGTCATATTG Exon 4FDXR P557 ATTAAGGAGCTTCGGGAGATG Exon 7 380P558 CTCTTATACCCAATGCTGCTG Exon 10CYP1 1A First pairP561 ... 295P582 CTTGCTCATGTCAACAGACTG Exon 4FDXR P583 CTTGGAGTCATCCCCAACAC Exon 10 281P584 TGGCCTCGAGAGACTTCCTC Exon 12CYP1 1A P585 AGACTTCTTTCGACTCCTCAG Exon 4 693P586 CTGAAGTTCTCCAGCAGATTG Exon 8Fig. ... GCCTTTGAGTCCATCACTAAC Exon 4 628P562 CCAGTGTCTTGGCAGGAATC Exon 8Nested pairP563 ATGTGGCTGCATGGGACGTG Exon 4 390P564 TCTGCAGGGTCACGGAGATG Exon 7Mouse genesFDX1 P581 AAATTGGCGACTCTCTGCTAG Exon...
- 11
- 475
- 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... Estimation of Distributional SimilaritiesJun’ichi Kazama Stijn De Saeger Kow KurodaMasaki Murata†Kentaro TorisawaLanguage Infrastructure Group, MASTAR ProjectNational Institute of Information ... observations and thus decreases the ex-pectation value as expected.The Bayesian estimation and the expectationcalculation in Eq. 2 are generally difficult and usually require computationally ... A contained 3,740 words that are actuallyevaluated, with about 115 answers on average, and “B” contained 3,657 words with about 65 answers on average. Set “C” contained 8,853 words withabout...
- 10
- 472
- 0
Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot
... conjuncts may be changed. The unconditional conjuncts of a formula contain informa- tion that is more definite than the information contained in disjunctions. Thus a formula can be regarded as having ... descriptions containing general disjunction and non-local path expressions; 2. It delays expansion to DNF; 3. It can take advantage of fast unification algorithms for non-disjunctive directed graph ... grammatical descriptions that contain disjunctive information, and refined as necessary and appropriate for specific applications. While the range of speed achieved by a straightfQrward implementation...
- 8
- 361
- 0
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx
... function testsThe correlation analyses of the sensorimotor variablesrevealed that repositioning VE and ROM from the cervicalrotation test and Ra and Tr area from the postural sway testPerformance ... bythree of the authors and mr Larson, the engineer.Authors' contributionsUR participated in the design of the study, carried out thedata acquisition, and the statistical analyses and draftedthe ... conceived of the study,participated in the design, statistical analyses of the study and helped to draft the manuscript. All authors read and approved the final manuscript.Additional materialAcknowledgementsThe...
- 10
- 712
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM