báo cáo khoa học: "Nodulin 41, a novel late nodulin of common bean with peptidase activity" pot

... 413ttgattttcaagtggagtatgatctcgaagggaagaaagtttcttttcaacctactgattgctctaaagtttaaa 1350I D F Q V E Y D L E G K K V S F Q P T D C S K V * 437ataatatatatatatatatataataataataataataataataatatgatatatatgtatgtgtaaaataaagaa ... 263tcgggaacgaatcaataataacgggagaaggtgttgtatccactccgatgataatcaaaccgtggttaccgacct 900F G N E S I I T G E G V V S T P M I I K P W L P T 288attactttctgaaccttgaagccgtcaccgttgcacaaaagacggtgccaacggggagcactgacggcaacgtga ... tttgggtacaatgttccccttgtgccagttgtttcccccaaagcaccccattgtttcaaccactcaaatcttcca 450I W V Q C S P C A S C F P Q S T P L F Q P L K S S 138X X V Q cgttcatgcctaccacatgtcgttcacaaccatgcaccttactcctccctgaacaaaaaggatgtggaaaatcag 525T...

Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inﬂammation pptx

... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG5 1028 A. Ray et al. ... variant of the SAF-1/MAZ/Pur-1family, is expressed during inﬂammationAlpana Ray1, Srijita Dhar1, Arvind Shakya1, Papiya Ray1, Yasunori Okada2and Bimal K. Ray11 Department of Veterinary ... wecompared its transactivation potential with that of SAF-1. The SAF-3 expression plasmid transactivatedexpression of the SAF-3X-CAT reporter at a muchhigher level than the same amount of SAF-1...

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed ... primersdisSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, respectively. ... http://mips.gsf.de/proj/yeast/info/tools/hegemann/gfp.html) using the primersSUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢,...

Báo cáo khoa học: BGN16.3, a novel acidic b-1,6-glucanase from mycoparasitic fungus Trichoderma harzianum CECT 2413 ppt

... Trichoderma harzianum.Mol Gen Genet 247, 639–645.19 Oyama S, Yamagata Y, Abe K & Nakajima T (2002)Cloning and expression of an endo-1,6-beta-d-glucanasegene (neg1) from Neurospora crassa. Biosci ... Plant Dis 87,4–10.4 Hermosa MR, Grondona I, Iturriaga EA, Diaz-MinguezJM, Castro C, Monte E & Garcia-Acha I (2000) Mole-cular characterization and identification of biocontrolisolates of ... characterization of chitinases as a tool for the identification of Trichoderma harzianumstrains. Mycol Res 102, 373–377.9Va´zquez-Garciduenãs S, Leal-Morales CA & Herrera-Estrella A...

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, speciﬁcally expressed in the olfactory epithelium in a zone-speciﬁc manner doc

... (5¢-GAATTCatgaaggttctcctccactg-3¢)and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢)for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggctgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagctgaccaaactccttg-3¢)forMACS1, ... 5¢-ccttctggggcactgagatg-3¢ (forward), 5¢-agaacgcatgcagccgaggg-3¢ (reverse); KS2 5¢-tggtagctacctgggaagcc-3¢ (forward), 5¢-gaagcaccagactcattctg-3¢ (reverse);MACS1 5¢-gagttggagctccaagctgg-3¢ (forward), ... OCAM5¢-gagaagtggtgtcccctcaa-3¢ (forward), 5¢-cctccatcatcttgcttggt-3¢ (reverse); NCAM 5¢-cttcctgtgtcaagtggcag-3¢ (for-ward), 5¢-gttggcagtggcattcacga-3¢ (reverse); and NeuroD5¢-aagacgcatgaaggccaatg-3¢...

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

... crucial to stabilize the organiza-tion of transvacuolar strands and maintain overallcellular architecture. As mentioned above, CRP1 mayparticipate in the formation and ⁄ or maintenance of long ... werevisualized using transmission electron microscopy (HitachiLtd., Saitama, Japan) at an accelerating voltage of 80 kVand a nominal magniﬁcation of ·100 000 [18].Measurement of contractionC2C12 ... (P) and supernatants (S) were analyzed by SDS ⁄ PAGE and stained with Coomassie Brilliant Blue. (C)Quantitation analysis for GST–hhLIM association with F-actin at different concentrations of...

Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

... theseptal nacreous layer of Nautilus macromphalus L.(Mollusca, Cephalopoda). Zoology 109, 85–95.33 Zhao H, Samata T, Takakura D, Hashimoto R,Miyazaki Y, Nozawa T & Hikita Y (2003) Organicmatrix ... Nagakura T, Ohkubo T, Sakagu-chi K, Tanaka M, Nakashima K & Takahashi T (1997)Structure of mollusc shell framework proteins. Nature387, 563–564.3 Suzuki M, Saruwatari K, Kogure T, Yamamoto ... resultinghydrolysate was analyzed on an HP 1090 Aminoquant(Hewlett-Packard, Palo Alto, CA, USA) [49] by an auto-mated two-step precolumn derivatization with O-phthalal-dehyde for primary and N-(9-ﬂuorenyl)methoxycarbonylfor...

Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

... gagt … ccac ag GGATGT 1.43105 a TAACAG gt aata … ttcc ag ACGTAT 6.54 250 TATCTG gt atgt … taac ag GATATG 0.895120 ACGGAG gt aaaa … tccc ag CAACTC 1.76138 GTTTTG gt aaga … attt ag GGCAGT 0.527117 ... 7.74262 a TACTTG gt atgt … aatc ag GATATG 1.35120 a ACAGAG gt aaaa … tctc ag AAAATT 9.96 138 GCATTG gt aagg … attt ag GGCAGT 1.27117 CATTAT gt aagt … tttc ag GATATT 0.178160 TTGCAG gt ttgt ... … ttta ag GTTCAA 1.29182 ATGGAC gt atgt … cata ag ATGTCC 3.810 994AAGGAC gt aagt … ttaa ag GATTGC 0.7011176 AGAAGA gt aagt … ttgc ag CAATTT 5.412130 ATGTTG gt aagt … tttt ag GGCATA 6.31385...

báo cáo khoa học: " Percussion hemoglobinuria - a novel term for hand trauma-induced mechanical hemolysis: a case report" doc

... Vasudev2, Barbara A Bresnahan1, Eric P Cohen1, Parameswaran N Hari3, Sundaram Hariharan1andBrahm S Vasudev1*AbstractIntroduction: Extracorpuscular hemolysis caused by mechanical trauma has ... both genders and after a wide range of activities. It has been associated with walking, running andmarching [2], and also with Japanese fencing and karate[3]. A few authors have also described ... physical examina-tion was remarkable for a lack of costovertebral angle ten-derness and peripheral ede ma. He had multiple calluseson the palmar aspect of both thumbs and palms.His pre-drum playing...

Báo cáo khoa học: " Evidence for a novel gene associated with human influenza A viruses" pptx

... influenza A virus genomes was complicated by a variety of errors inthe available data sets. There are a number of minor andmajor (those that break essential genes) sequencing errorsincluding contamination ... for 1) translation of genomicRNAs or 2) generation of mRNAs with the same sequenceas genome strands has been proposed for influenza A virus. A thorough survey and analysis of influenza A virusgenomic ... [http://www.cdc.gov/mmwr/preview/mmwrhtml/mm581 7a1 .htm]62. Steel J, Lowen AC, Pena L, Angel M, Solorzano A, Albrecht R, PerezDR, Garcia-Sastre A, Palese P: Live attenuated influenza virusescontaining NS1 truncations as vaccine candidates...

Xem thêm