0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa hoc:" The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study" ppsx

Báo cáo khoa hoc:

Báo cáo khoa hoc:" The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study" ppsx

... TTC CTA ACC TTG TTC 3’ 250 58 KCNE2 .1R 5’ GCC ACG ATG ATG AAA GAG AAC 3’ KCNE2 .2F 5’ GAT GCT GAG AAC TTC TAC TAT G 3’ 300 58 KCNE2 .2R 5’ GTC TGG ACG TCA GAT GTT AG 3’ KCNE3 F 5’ GCT AAG ATT TTA CCT ... beenassociated with hypo- and hyper-kalemia and paralysis[7], and here it was found in two cases. In one family the mutation was co-inherited with a mutation in troponin Tand in another the ... and/or abnormal splicing;2) if relevant, the variation affected a conserved aminoacid; 3) the variation co-segregated with the disease in affected family members and; 4) if the variation was notidentified...
  • 5
  • 444
  • 0
báo cáo khoa học:

báo cáo khoa học: " The membrane-spanning 4-domains, subfamily A (MS4A) gene cluster contains a common variant associated with Alzheimer’s disease" potx

... Fuensanta Noguera-Perea1, Agustina Legaz-Garc a 1,Laura Vivancos-Moreau1, Juan Velasco5, José Miguel Carrasco5, Montserrat Alegret3, Martirio Antequera-Torres1,Salvadora Manzanares1, ... suggesting a ro le for the immune system in the pathogenesis of AD. The other genes within the candidate block a re poorly character-ized and it is not easy to delineate a plausible hypothesisfor ... them yet.Data accessGWAS data from Spanish patients is available for quali-fied researchers after institutional review board approvalby the Comunidad Autónoma de la Región de Murcia(Spain)....
  • 8
  • 391
  • 0
Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc

Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc

... RT-PCRPsy1R381 CCTCGATGAATCAAAAAAACGGTaqManPsy1 TCATGGAATCAGTCCGGGAGGGAAPsy2 Psy2F952 AGGCAAGGCTGGAAGATATTTTT EF534738 72 RT-PCRPsy2R1024 GAAACAGTGTCGGATAAAGCTGCTaqManPsy2 ACGGGCGGCCATTTGATATGCTTGPsy1 ... GGCCATTGTTGAAAGAGAGG EF534739 1522 CloningPSY1Rev1522 TCATGCTTTATCTTTGAAGAGAGGPsy2 PSY2For27 TCTCTACGTGTATCAAAGGTAGTAAGG EF534738 1674 CloningPSY2Rev1674 TGGCATTTAGAAACTTCATTCAFig. 1. Comparison ... accessionnumberAmplicon(bp) Use18SrRNA Le18SrRNA-F-118 GAAACGGCTACCACATCCAAG BH012957 61 RT-PCRLe18SrRNA-R-179 CCCCGTGTTAGGATTGGGTTaqMan-Le18s-140 AAGGCAGCAGGCGCGCAAAPsy1 Psy1F312 TGACGTCTCAAATGGGACAAGT EF534739...
  • 9
  • 607
  • 0
Báo cáo khoa học: Two CYP17 genes in the South African Angora goat (Capra hircus) – the identification of three genotypes that differ in copy number and steroidogenic output pptx

Báo cáo khoa học: Two CYP17 genes in the South African Angora goat (Capra hircus) – the identification of three genotypes that differ in copy number and steroidogenic output pptx

... (sense)CAATGATGGCATCCTGGAGReal-time CYP17RP (antisense)GAGGCAGAGGTCACAGTAATCYP17 sensorprobeTTCTGAGCAAGGAAATTCTGTTAGAC-FLCYP17 anchorprobe640-TATTCCCTGCGCTGAAGGTGAGGA-pReal-time 3bHSDLP ... K, Yasuda K, Yanase T, Yamakita N, SasanoH, Nawata H, Inoue M, Fukaya T & Shizuta Y (1996)Mutation of cytochrome P-4501 7a gene (CYP17) in a Japanese patient previously reported as having ... sequences in GenBank (GenBankaccession nos. L40335 and AF251388) are two allelesof the same gene (Fig. 3).These data reveal the novel finding that, in both the South African Angora goat and the Boer...
  • 10
  • 548
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:"SRY-related genes in the genome of the rice field eel (Monopterus albus)" docx

... t at t cact aat ggat gcagtggt t gt t caggcagcaggt gat gtt att aaaagt t act gcat ct gggt t acgcat cagat gt aacct 345caagaat ct gt ccct gt ccccaaaaat ggcaacaagct at t t t t gt gt gcat caccagact ... gtaccagat ct at acaggat at t at t caaccacat t ct t ct at t ccacacagtt t ct gaat t t gaggtgct t ct gt at t t agt t t t aat t cat gt ct agtt gat t t t a 230t t ct t act ct acgcaaacaacagt t aat ... t a t t t aga a t t ga gt gt a gc c c t a c a ct t gc t t t t gca c t t t gc ac aga c a ga ga 300 at at t t a gt t t cg t c ct t c a t at t a t t ga c gt t aa aa c a at t a at gc at agt a aat...
  • 9
  • 343
  • 0
Tài liệu Báo cáo khoa học: The unique sites in SulA protein preferentially cleaved by ATP-dependent Lon protease from Escherichia coli ppt

Tài liệu Báo cáo khoa học: The unique sites in SulA protein preferentially cleaved by ATP-dependent Lon protease from Escherichia coli ppt

... incubation in the presence of ATP and after 3 h of incubation in the absenceof ATP w ere also analyze d in the same way. The yields of the fragments were estimated b y amino-acid analyses. The results ... are strategically placed mainly in the centralregion of SulA so that the cleavage at any of these siteswould lead to rapid inactivation of the protein. As for the C-terminal region, it is interesting ... here and that Gln was abundant in positions P2±P5, especially in the ÔfastÕ cleavage sites.On the o ther hand, degradation was very slow in the absence of ATP (Fig . 3 ), indicating that the...
  • 7
  • 358
  • 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... remainelusive. Vps4 has an N-terminal microtubule interacting and traffickingdomain required for endosome recruitment, an AAA domain containing the ATPase catalytic site and a b domain, and a ... the Arg residues in the SRH (red) andWalker A and B motifs (black) are shown. The colour code for the remainder of the protein is: large AAA subdomain, pink; small AAAsubdomain, beige; b domain, ... (SRH). The SRHdistinguishes AAA family ATPases from otherWalker-type ATPases [21]. A pair of conserved Argresidues within this motif activate ATPase activity in an adjacent ATPase domain [22,23]...
  • 23
  • 490
  • 0
Báo cáo khoa học: The hepoxilin connection in the epidermis docx

Báo cáo khoa học: The hepoxilin connection in the epidermis docx

... or a signaling function in differentiation [9], and we arenot much further advanced in defining the mechanismtoday. Genetic analyses of mutant skin phenotypeshave paved the way for unraveling ... hepoxilins in maintaining the epidermal water barrier. Whereasmouse eLOX3 has the required activity with fatty acidhydroperoxides, mouse 12R-LOX is very unusual in apparently lacking oxygenase activity ... products haveany structural role and ⁄ or act as specific signaling mol-ecules in contributing to the epidermal water barrier.Also awaiting clarification is linoleic acid metabolismby 12R-LOX, the...
  • 9
  • 402
  • 0
Báo cáo khoa học: The Y42H mutation in medium-chain acyl-CoA dehydrogenase, which is prevalent in babies identified by MS/MS-based newborn screening, is temperature sensitiv pptx

Báo cáo khoa học: The Y42H mutation in medium-chain acyl-CoA dehydrogenase, which is prevalent in babies identified by MS/MS-based newborn screening, is temperature sensitiv pptx

... nvestigated, to distinguish b etween a ÔbenignÕ MCAD variant that causes an abnormal acylcar-nitine pattern, but is unlikely to cause disease, and a Ôdisease-causingÕ MCAD variant. Therefore we have ... Using SRCDanalysis to study thermal stability of the MCAD variants weshow that the secondary structure of MCAD is maintainedup to the t emperature where a gross change in the folding(leading ... showedthat the Y42H mutation only had a minimal effect on the catalytic activity of the enzyme, the prosthetic groupbinding, or interaction with the natural electron acceptor.Together these d ata...
  • 11
  • 429
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " The Signal System in Interlingua — A Factor in Mechanical Translation" potx

... Russian balalaika and a resonant Spanish guitar, and so forth make fascinating material for descriptive and analytical studies in some branch of meta- linguistics. But no fundamental research ... resynthesis in the translator's mind, the translator himself must not be aware of them any more than a healthy diner is aware of what happens to a slice of steak on its way to generating a new ... translation and of mechanical translation in par- ticular is not that the signal system of departure language and target language be complete in any absolute sense of the term but rather that...
  • 6
  • 338
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam