báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx

... Iron Score. Based on these groupings, a univariate relative risk of death was calculated for each iron parameter using haz-ard regression analysis.Survival time was measured from the date of transplant ... one was classified as a "low" score. Forpurposes of comparing the Transplant Iron Score to otherindividual or combinations of iron parameters, each iron parameter was scaled be scored ... discriminate survival based on a comparative analysis of hazard ratios.Ultimately, these three iron parameters were incorporatedinto a unified scoring system. For each patient, a score wascalculated...

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

... 912–919.66 Kuroda J, Kimura S, Strasser A, Andreef A, O’ReillyLA, Ashihara E, Kamitsuji Y, Yokota A, Kawata E,Takeuchi M et al. (2007) Apoptosis-based dual mole-cular targeting by INNO-406, a second-generationBcr ... 3¢-kinase; PKB, protein kinase B (also known as Akt); PUMA, p53-upregulated modulator of apoptosis; RACK1, receptor for activated C-kinase-1; RAS, rat sarcoma virus concogene;RNAi, RNA interference; ... Cartlidge S & Smith PD (2007)AZD6244 (ARRY-142886), a potent inhibitor of mito-gen-activated protein kinase ⁄ extracellular signal-regu-lated kinase kinase 1 ⁄ 2 kinases: mechanism of action...

Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

... DGH2OD-values(conformational stability in absence of denaturant) wasthen calculated.[3H]-cGMP binding assayTo assay the capability of PKG wild-type to bind cGMP atdifferent urea concentrations, ... Genetic Analyzer at the DNA-AnalysisCore Facility, University of Vermont (Burlington, VT,USA). Preparation of bacumid DNA, transfection of Sf9cells and two rounds of Baculovirus ampliﬁcation ... (cGMP) was purchased from Biolog (Bremen,Germany),3[H]-cGMP was purchased from ICN Biomed-icals (Irvine, CA, USA) and had a speciﬁc activity of 30 CiÆmmol)1. All other chemicals were purchased...

Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx

... thebifunctional enzymes chorismate mutase–prephenate dehydratase and chorismate mutase–prephenate dehydratase were deleted. Monofunctionalversions of the dehydratase and the dehydrogenase are provided ... overall reaction [50]. A rationally designed variant of L-Ala-D/L-Glu epimerase (a third member of the enolase superfamily, Fig. 8),containing a mutation (D297G) analogous to that of theE223G ... by plasmid pKIMP-UAUC. Random gene libraries are introduced into this strainand the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added...

Báo cáo khoa học: "The Back-translation Score: Automatic MT Evaluation at the Sentence Level without Reference Translations" pptx

... 35 43002 Tarragona, Spain reinhard.rapp@urv.cat Abstract Automatic tools for machine translation (MT) evaluation such as BLEU are well established, but have the drawbacks that they do ... 2009.c2009 ACL and AFNLPThe Back-translation Score: Automatic MT Evaluation at the Sentence Level without Reference Translations Reinhard Rapp Universitat Rovira i Virgili Avinguda Catalunya, 35 ... requires a human-generated ref- HUMAN EVALUATION AUTOMATIC EVALUATION OF FORWARD-TRANSLATION AUTOMATIC EVALUATION OF BACK-TRANSLATION FLU-ENCY A DE-QUACY MEAN NIST BLEU ORTHO-BLEU NIST...

Tài liệu Báo cáo khoa học: The cellulosomes from Clostridium cellulolyticum Identiﬁcation of new components and synergies between complexes ppt

... identified as the mannanase Man2 6A [14]. Lastly, protein 13 was identified as an N-terminaldockerin-borne chagasin domain. Chagasin belongs toFig. 4. Enzymatic activities of the cellulosome fractions ... straw,all fractions showed a substantial level of activity thatwas never less than half that of the most active frac-tion, F1. On Avicel, F5 was the most efficient fraction,and the least active ... havebeen found in C. cellulovorans cellulosomes, whereas a bifunctional GH30 -a- l-arabinofuranosidase B has beendetected in C. thermocellum cellulosomes [33]. The cata-lytic domain of C. cellulolyticum...

Tài liệu Báo cáo khoa học: The lipid ⁄ protein interface as xenobiotic target site Kinetic analysis of tadpole narcosis ppt

... volatileanesthetics. Anesth Analges 95, 578–582.38 Takasaki M, Tatara T, Suezaki Y, Shirahama K,Kamaya H, Ueda I & Totoki T (1991) Effect of inhala-tion anesthetics on swimming activity of Artermiasalina. ... of comparable quality. Overall, statistical quality wasdetermined by the quality of the data sets used.DiscussionAnimal narcosisNarcosis is assessed by some all-or-none quantalresponse of ... the standard two-parameter ﬁts of the Gaussand logistic procedures [34]. As expected, two variableparameters generally produced a better ﬁt, but themechanism-related model was, at least for...

Báo cáo khoa học: The 2-oxoacid dehydrogenase multi-enzyme complex of the archaeon Thermoplasma acidophilum ) recombinant expression, assembly and characterization docx

... CTACGAGAGCTAGCATGTACGATGCAATAATAATAGGTTCE3 reverse: TTTAAAAATGGAATTCAATGAGATGGT.PCR ampliﬁcation was carried out using Vent polymer-ase, and A- tails were added to the products with Taq poly-merase. Both ... Oligonucleotideswere as follows (restriction sequences are underlined):E2 forward: CGCCATATGTACGAATTCAAACTGCCAGACATAGGE2 reverse: CCGCTCGAGTCAGATCTCGTAGATTATAGCGTTCGGE3 forward: CTACGAGAGCTAGCATGTACGATGCAATAATAATAGGTTCE3 ... glycerol. Peak fractionswere assayed for E1, E3 and OADHC activity.Analytical ultracentrifugationAll analytical ultracentrifugation experiments were carriedout on a Beckman XL -A analytical ultracentrifuge...

Báo cáo khoa học: " The Signal System in Interlingua — A Factor in Mechanical Translation" potx

... Russian balalaika and a resonant Spanish guitar, and so forth make fascinating material for descriptive and analytical studies in some branch of meta- linguistics. But no fundamental research ... view of translation and of mechanical translation in par- ticular is not that the signal system of departure language and target language be complete in any absolute sense of the term but rather ... translator's mind, the translator himself must not be aware of them any more than a healthy diner is aware of what happens to a slice of steak on its way to generating a new supply of...

Báo cáo khoa học: "The Human Language Project: Building a Universal Corpus of the World’s Languages" pptx

... language as the meaning representation, we arrive back at ma-chine translation as the measure of success. Inshort, we have successfully captured a language ifwe can translate into and out of ... approximation to language understanding.Here is another way to put it. One measure of adequacy of a language digitization is the abil-ity of a human—already ﬂuent in a referencelanguage—to acquire ﬂuency ... goals for numbers of lan-guages, data per language, and coverage of lan-guage families (Whalen and Simons, 2009).Machine readability and consistency. “Cover-ing” languages means enabling machine...

Xem thêm