báo cáo khoa học: "Individualized therapies in colorectal cancer: KRAS as a marker for response to EGFR-targeted therapy" docx

... metastatic colorectal cancer. KRAS and skin rash are independent predictive markers for response to EGFR-targeted monoclonal antibody therapies Long before KRAS emerged as a predictive marker ... extracellular domain has the ligandbinding site and also contains specific sequences that areinvolved in dimerization, while the intracellular domainis a catalytic site that has tyrosine kinase ... Guaninenucleotide activating protein (GAP) class, for exampleRasGAP. KRAS can also facilitate the release of boundnucleotide by binding to proteins of the Guanine Nucle-otide Exchange Factor...

báo cáo khoa học: "Novel therapies in genitourinary cancer: an update" doc

... treat-ment failure of tyrosine kinase inhibitors.Everolimus was also evaluated in combination therapywith sorafenib in a phase I study as well as with bevacizu-mab in a phase II study at ASCO ... October 16, 2007 it was approved for the treatment ofmetastatic, refractory breast cancers in combination withcapecitabine. A phase II study was presented at ASCO2008 investigating its activity ... therapy for metastatic bladder can-cer has been cisplatin-based therapy for the past 20 years. In recent years, the combination of methotrexate, vinblas-tine, doxorubicin and cisplatin (M-VAC)...

báo cáo khoa học: "Novel therapies in breast cancer: what is new from ASCO 2008" ppsx

... Toxicity Evaluation at ASCOLapatinib EGFR/HER2 Diarrhea, rash, nausea, vomiting -monotherapy in inflammatory BC-c/w trastuzumab-c/w bevacizumabHKI-272 Pan HER Diarrhea, nausea n /a Trastuzumab DM-1 ... currentlyreached accrual and is awaiting data analysis.[11] It is alsocurrently being evaluated in phase I/II studies in combina-tion with paclitaxel as well as in combination with vinor-elbine in patients ... heavily pretreated patients.Enzastaurin is a potent serine-threonine kinase inhibitorwhich selectively targets PKCβ and PI3K/AKT signalingpathways and was evaluated at ASCO 2008 in a phase...

báo cáo khoa học: " Transcriptome instability in colorectal cancer identified by exon microarray analyses: Associations with splicing factor expression levels and patient survival" docx

... correspondsapproximately to one exon, and will be referred to as such herein. The arrays were finally washed, stained andscanned according to the manufacturer’s protocol.Data analysisScanning of ... CRC samples, in the same manner as for the splicing factor genes.ResultsVariation in the amounts of aberrant alternative exonusage among colorectal cancer tissue samplesExon microarray profiles ... CB, Meling GI, Aagesen TH, Ahrens CH, Rognum TO, Lothe RA: WNT1 inducible signaling pathway protein 3, WISP-3, a noveltarget gene in colorectal carcinomas with microsatellite instability.Gastroenterology...

Báo cáo khoa học: "Young patients with colorectal cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic markers" pot

... physical examination, including digital rectalexamination and CEA level every three months. A chestradiograph and trans-abdominal ultrasound scan orcomputerized tomogram was undertaken at one ... patientswith colorectal cancer were compared with forty sevenpatients from the same database, over 50 years old, in whom all comparable data were available (Table 1).Again, consecutive sampling as employed ... multifactorial analysis. Dis-ease free survival was analysed for all patients and alsowith reference to resection margin positivity (R0/1 sta-tus). Statistical analysis was performed using the...

Báo cáo khoa học: "Extracorporeal therapies in acute rhabdomyolysis and myoglobin clearance" ppsx

... removal of circulatingmyoglobin. In a recent paper, Naka and colleagues have proposedthe use of a super-high-flux membrane in continuous hemofiltration.The removal of myoglobin was greater than ... Naka andcolleagues concluded an interesting study on myoglobinclearance by hemofiltration using a ‘super-high-flux’membrane in a case of acute rhabdomyolysis [2].The paper is of peculiar interest ... optimal application will involve intermittentfrequency. In contrast, a less efficient system, capable ofmaintaining the levels at a steady state, can cope with thedaily generation but needs to...

Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke docx

... stroke,because glutamate-induced excitotoxicity has beenthought of as the main reason for neuronal cell death.Although NMDA receptor activation in the acutephase leads to neuronal damage, the same ... dysregulation of neurovascular pro-teases has been implicated as central in neurovascularinjury after stroke. In particular, the matrix metallo-proteinase (MMP) family of extracellular proteases ... concept that neu-rovascular recovery in fact, utilizes the same mediatorsthat appear to underlie acute injury. As discussed above, a major mediator in typicallyinvolved in neurovascular responses...

Tài liệu Báo cáo khoa học: Antioxidant defences in cybrids harboring mtDNA mutations associated with Leber’s hereditary optic neuropathy docx

... cybrids in gal-DMEM. In contrast,GSH markedly increased in cells carrying the3460 ⁄ ND1 and 11778 ⁄ ND4 mutations, which onceagain showed similar behavior. A 12-h incubation in galactose caused a ... proteinÆmin)1.Total catalase activity was assayed by the method ofAebi [45]. Activity was measured by monitoring, for 30 s at25 °C, the decomposition of 10 mm H2O2at 240 nm in a medium ... SR, Wong A, Carelli V, Martinuzzi A, Scha-pira AHV & Cortopassi AG (2002) Cells bearing muta-tions carrying Leber’s hereditary optic neuropathy aresensitized to Fas-induced apoptosis. J...

Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

... is a malignant neoplasm thatrepresents the early trophoblast of the attachment phase or as later invasive stage [46–48]. Thus, in most cases,choriocarcinoma has the appearance of trophoblast, ... 39,495–508.17. Alsat, E. & Malassine, A. (1991) High density lipoprotein inter-action with human placenta: biochemical and ultrastructuralcharacterization of binding to microvillous receptor and lack ... choriocarcinoma cell lines was isolated byusing RNeasy kit (Qiagen, Vienna, Austria). Three micro-grams of total RNA were treated with RQ1 RNase-freeDNase I (Promega, Mannheim, Germany) for 15 min...

Báo cáo khoa học: Identiﬁcation of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... ACAGCAAAAAGGAGGCCAAA 138BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 ... 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114BC037851 CACAGCTCCCATTCATTCCA TCCCTTTGCCTCCTGTTGTT ... carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladdercarcinomas and non-small cell lung carcinomas. CA9is strongly induced by hypoxia via the transcriptionfactor...

Xem thêm