Báo cáo y học: "Health system weaknesses constrain access to PMTCT and maternal HIV services in South Africa: a qualitative enquiry" pptx
Báo cáo y học: "Health system weaknesses constrain access to PMTCT and maternal HIV services in South Africa: a qualitative enquiry" pptx
... this article as: Sprague et al.: Health system weaknesses constrain access to PMTCT and maternal HIV services in South Africa: a qualitative enquiry. AIDS Research and Therapy 2011 8:10.Submit your ... Research and Therapy 2011, 8:10http://www.aidsrestherapy.com/content/8/1/10Page 3 of 9RESEARCH Open Access Health system weaknesses constrain access to PMTCT and maternal HIV services in South ... practices in pediatric ARV rollout and integration with early childhood programs in South Africa: A rapid situational analysis. (University of Cape Town Schoolof Child and Adolescent Health and...
- 9
- 404
- 0
Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx
... CAAACTCTTTTGCTTGGGCTR CACTGGACAACTCGCAGATGAF125041Biglycan 65 204 F CCATGCTGAACGATGAGGAAR CATTATTCTGCAGGTCCAGCAF034842Fibromodulin 65 442 F CTGGACCACAACAACCTGACR GGATCTTCTGCAGCTGGTTGAF020291Lumican ... CCTCCAGGTCAGCTTCGCAANM174030Collagen I 65 460 F CCACCAGTCACCTGCGTACAR GGAGACCACGAGGACCAGAAAF129287Collagen III 55 243 F GCTGGCTAGTTGTCGCTCTGR GTGGGGAAACTGCACAACATL47641GAPDH 55 320 F TCACCATCTTCCAGGAGCGAR GGCGTGGACAGTGGTCATAAAF035421Shown ... animalsmay permit analysis of affected and unaffected cartilage withinone joint area.Although morphological and histological changes in cartilagewere most notable in the lateral compartment, changes...
- 10
- 416
- 0
Báo cáo Y học: Identification of residues critical for activity of the wound-induced leucine aminopeptidase (LAP-A) of tomato pptx
... C a of Glu and itscarboxylate oxygen, C a of Asp a nd its carboxylate oxygen,C a of Arg and its side-chain amines or guanidinium, and C a of Lys and its side-chain amine was determined bymeasuring ... metallopeptidases that have high temperature and pH optima and are inhibited by the potent amino-peptidase inhibitors amastatin and bestatin [3,4]. Analysis ofamino acyl-p-nitroanilide and -b-naphthylamide ... eight LAPsareshadedingrey.ResiduespredictedtohavearoleinZnionbinding(m)andcatalysis(d) are in dicated [1,24]. Residues po stulated to in- teract bestatin or amastatin are located in a hyd rophobic...
- 11
- 423
- 0
Báo cáo hóa học: " Health-related quality of life of child and adolescent retinoblastoma survivors in the Netherlands" ppt
... enucleation and EBRT, d) different combina-tions of chemotherapy and remaining therapies (thermo-chemotherapy, laser photocoagulation, plaque therapy and cryotherapy)[5]. Visual acuity was defined ... gender, agegroup (8–11 years or 12–18 years), marital status of par-ents, heredity, type of treatment, and visual acuity. Prelim-inary analyses showed interdependency of all illness-related factors ... study. An example we sometimesencountered in clinical practice is that RB survivors oftenhave a different facial appearance due to the treatment;this may often lead to bullying and staring. In...
- 8
- 385
- 0
báo cáo hóa học:" Health-related quality of life of child and adolescent retinoblastoma survivors in the Netherlands" doc
... chemotherapy and remaining therapies (thermo-chemotherapy, laser photocoagulation, plaque therapy and cryotherapy)[5]. Visual acuity was defined as visualacuity after subjective refraction in the ... Sprangers MAG, FayersPM: The clinical significance of adaptation to changing health: A meta-analysis of response shift. Qual Life Res 2006,15:1533-1550.24. Barakat LP, Alderfer MA, Kazak AE: ... sometimesencountered in clinical practice is that RB survivors oftenhave a different facial appearance due to the treatment;this may often lead to bullying and staring. In this studywe found it important to...
- 8
- 254
- 0
Báo cáo y học: "Relationship among Dexamethasone Suppression Test, personality disorders and stressful life events in clinical subtypes of major depression: An exploratory study" pot
... Fountoulakis KN, Iacovides A, Ioannidou C, Bascialla F, Nimatoudis I,Kaprinis G, Janca A, Dahl A: Reliability and cultural applicabilityof the Greek version of the International Personality Disor-ders ... with Luminance Immunoassay (intra-essay reli-ability: 4.9%; inter-essay: 7.5%). Non-suppression cut-offlevel: 5 µg/dl.Statistical AnalysisMultiple Analysis of Variance (MANOVA) was performedwith ... severity marker rather thandirectly related to symptomatology. In patients withoutPD, DST NS (group B in figure 2) may relate to milderdepressed mood, higher denigratory attitude and hostil-ity,...
- 8
- 415
- 0
Báo cáo y học: "T-cell contact-dependent regulation of CC and CXC chemokine production in monocytes through differential involvement of NFκB: implications for rheumatoid arthritis" docx
... Quantitative analysis ofcytokine gene expression in rheumatoid arthritis. J Immunol1990, 144:3347-3353.13. Morita Y, Yamamura M, Kawashima M, Harada S, Tsuji K, ShibuyaK, Maruyama K, Makino ... Mukaida N, Mahe Y, Matsushima K: Cooperative interaction ofnuclear factor-κB- and cis-regulatory enhancer binding pro-tein-like factor binding elements in activating the interleukin-8gene by ... macrophage inflammatory protein 1 alpha (MIP-1α), macrophage inflammatory protein 1 beta (MIP-1β), RANTES) and CXC chemokines (IL-8, growth-related gene product alpha (GROα) and interferon-gamma-inducible...
- 10
- 456
- 0
Báo cáo y học: "Deficiency of functional mannose-binding lectin is not associated with infections in patients with systemic lupus erythematosu" pptx
... carbohy-drate-binding domain was concluded from its ability to inhibitbinding of MBL to mannan (data not shown).Assessment of MBL pathway activationMBL pathway activation was assessed by an ... mannose-binding lectin; SLE, systemic lupus erythematosus.Table 4Multivariate analysis of the first major infection (dependent variable) and clinical and therapy variables (independent variables)Variables ... deposition, and MBL pathway activityMannose-binding lectin (MBL) serum level, C4 deposition, and MBL pathway activity. Functional MBL activity measured by three assays in all patients with systemic...
- 10
- 325
- 0
Báo cáo y học: "Rutoside decreases human macrophage-derived inflammatory mediators and improves clinical signs in adjuvant-induced arthritis" doc
... they are capable of inducing otherproinflammatory cytokines and activating matrix metalloprotei-nases in autocrine and paracrine fashions [2]. Inhibitors of IL-1 and TNF-α cause a reduction in ... 2004,50:1457-1467.5. Kawanaka N, Yamamura M, Aita T, Morita Y, Okamoto A, Kawashima M, Iwahashi M, Ueno A, Ohmoto Y, Makino H: CD14+,CD16+ blood monocytes and joint inflammation in rheumatoidarthritis. Arthritis ... reactions by regulating the generationof inflammatory cytokines such as IL-6, TNF-α, and interferon-gamma and associated activation protein-1 (AP-1) and nuclear factor-kappa-B (NF-κB) signaling...
- 9
- 397
- 0
Báo cáo y học: "Human articular chondrocytes express 15-lipoxygenase-1 and -2: potential role in osteoarthritis" pdf
... 5'-AGAGTTGTCCCGATGATCTC-3'; MMP-13, sense 5'-CTTAGA GGT GAC TGG CAA AC-3' and antisense 5'-GCC CATCAA ATG GGT AGA AG-3'; and glyceraldehyde-3-phosphatedehydrogenase ... glyceraldehyde-3-phosphatedehydrogenase (GAPDH), sense 5'-CAGAACATCATCCCT-GCCTCT-3' and antisense 5'-GCTTGACAAAGTGGTCGTT-GAG-3'.Quantitative PCR analysis was performed in a total volume of50 μl containing ... 5'-TGTGTTCACT-GGGTGCAGAGA-3'; 15-LOX-2, sense 5'-GCATCCACTGATTGGACCTT-3' and antisense 5'-GCT-GGCCTTGAACTTCTGAC-3'; MMP-1, sense 5'-CTGAAAGTGACTGGGAAACC-3' and antisense...
- 12
- 771
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyendepartment of health and social development jobs in south africadepartment of health and social development vacancies in south africabáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ