Báo cáo y học: "Rheumatoid cachexia is associated with dyslipidemia and low levels of atheroprotective natural antibodies against phosphorylcholine but not with dietary fat in patients with rheumatoid arthritis: a cross-sectional study" pdf
Báo cáo y học: "Rheumatoid cachexia is associated with dyslipidemia and low levels of atheroprotective natural antibodies against phosphorylcholine but not with dietary fat in patients with rheumatoid arthritis: a cross-sectional study" pdf
... statistical analysis.Results Dietary intake and fatty acid profilesThe mean dietary intake of total energy, carbohydrate, protein and fat is shown in Table 2. Compared with the Swedish FoodRecommendations ... energy percentage; FA, fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; SFA, saturated fatty acid.Available online http://arthritis-research.com/content/11/2/R37Page ... AN, Papavasiliou EC, Lourida ES, Alamanos Y, KostaraC, Tselepis AD, Drosos AA: Atherogenic lipid profile is a featurecharacteristic of patients with early rheumatoid arthritis: effect of early...
- 11
- 549
- 0
Báo cáo y học: " Food assistance is associated with improved body mass index, food security and attendance at clinic in an HIV program in central Haiti: a prospective observational cohort study" docx
... care by impacting a bility to take antire-troviral medications in a number of ways, includingcausing symptoms of nausea while taking medicationson an empty stomach, increasing drug toxicity, ... I, et al: Adherence to antiretroviral therapy in Sub-Saharan Africa and North America: a meta-analysis. JAMA 2006,296(6):679-90.37. Bassett I, Wang B, Chetty S, et al: Loss to care and death ... status at the time of baselineevaluation. This analysis demonstrated that at 6 and 12 months food assistance was associated with improve-ments in food security (P < 0.001 and P = 0.03) and...
- 8
- 438
- 0
Báo cáo y học: "Preoperative statin is associated with decreased operative mortality in high risk coronary artery bypass patients" pot
... osis of coronary artery disease and the statin is not alwaysstarted before operation, especially in the urgent orTable 2 Study Population and results of bnivariateanalysis of statin groupsAll ... study design, manuscript preparation, and presentation at national meeting. DAD assisted in study design and statistical analysis. KAS developed the database and performed statisticalanalysis. ... undergoes a major cardiac procedure is recordedon a standardized form and entered into the databaseby trai ned datab ase staff during the admission and immediately following discharge. Data is collected...
- 5
- 399
- 0
Báo cáo y học: "Rheumatoid arthritis is an independent risk factor for multi-vessel coronary artery disease: a case control study" pdf
... groups.Characteristics of cases with RA and CADTable 1 includes characteristics of the patients with RA. Aver-age age at onset of RA was 55 years and the average diseaseAvailable online http://arthritis-research.com/content/7/5/R984R990without ... contributes to accelerated CAD.The inflammatory mechanisms in RA may enhance atherogen-esis in several ways. C-reactive protein, a useful marker of dis-ease activity, is elevated in RA and has prognostic ... scleritis. Use of corticosteroids and disease modifying therapy was fairly typi-cal of patients with long-standing RA.Coronary artery involvementThere was a statistically significant difference in...
- 8
- 401
- 0
Báo cáo y học: "Rheumatoid cachexia: a complication of rheumatoid arthritis moves into the 21st century" potx
... jointinflammation improves. Rheumatoid cachexia may be an importantrisk factor for cardiovascular disease and excess mortality in RA. In this issue of Arthritis Research & Therapy, Elkan and ... in fact, loss of body fat- free mass is oftenaccompanied by increased fat mass and stable body weight. Rheumatoid cachexia may affect up to two-thirds of all patients with RA [3,4]. Elkan and ... and concomitant increase in fat mass, is very common in patients with rheumatoid arthritis (RA). Despite great advances in the treatment of RA, it appears that rheumatoid cachexia persists even after jointinflammation...
- 2
- 257
- 0
Báo cáo y học: "Serum cholesterol concentration associated with aspirin esterase activity in older people: preliminary data"
... circulation where two distinct aspirin hydrolysis pathways act: a spontaneous pH-dependent hydrolysis and an en-zymatic hydrolysis by plasma/serum and erythrocyte esterases (6). The circulating ... aspirin hydrolysis occurs in blood, there is a paucity of information in regards to circulating aspirin esterase activity in various physiological and pathological conditions. High aspirin esterase ... with those of serum aspirin esterase activity in an older population that participated in a physical activ-ity modification program. Although aspirin metabol-ism is probably multi-factorial,...
- 4
- 609
- 1
báo cáo hóa học: " Severe depression is associated with increased microglial quinolinic acid in subregions of the anterior cingulate gyrus: Evidence for an immune-modulated glutamatergic neurotransmission?" doc
... kynureninepathway, indoleamine 2,3-dioxygenase (IDO), and the enzyme that catalyses the production of 3-OH-kynurenine, kynurenine monoxygenase(KMO), are activated by proinflammatory cytokines, including interleukin-1 ... Effects of ketamine on anteriorcingulate glutamate metabolism in healthy humans: a 4-T proton MRSstudy. Am J Psychiatry 2005, 162:394-396.30. APA: Diagnostic and Statistical Manual of Mental Disorders, ... Luckenbaugh DA, Salvadore G, Machado-Vieira R, Manji HK, Zarate CA Jr: A randomized add-on trial of an N-methyl-D-aspartate antagonist in treatment-resistant bipolar depression.Arch Gen Psychiatry...
- 9
- 507
- 0
báo cáo hóa học:" Elevated osteoprotegerin is associated with abnormal ankle brachial indices in patients infected with HIV: a cross-sectional study" pptx
... DAAassisted in collecting data and creating the database, the interpretation of study findings, and the critical revision the manuscr ipt. MW assisted in data and statistical analysis, interpretation of ... is- tory of cardiovascular and cerebrovascular diseases wasobtained by self-report and/ or cha rt review. History of cardiovascular disease, including documented history of coronary artery disease, ... coronary artery disease, myo-cardial infarction and stroke) was significantly associated with definite PAD. From the NHANES database, there is almost a doubling in the prevalence of PAD in menwith...
- 6
- 381
- 0
Báo cáo y học: "Circulating RANKL is inversely related to RANKL mRNA levels in bone in osteoarthritic males" potx
... GAPDH, forward: ACCCAGAAGACTGTGGATGG;GAPDH, reverse: CAGTGAGCTTCCCGTTCAG; OPG, for-ward: CTGTTTTCACAGAGGTCAATATCTT; OPG, reverse:GCTCACAAGAACAGACTTTCCAG; and RANKL, forward:CCAAGATCTCCAACATGACT; ... Hikita A, Yana I, Wakeyama H, Nakamura M, Kadono Y, Oshima Y, Nakamura K, Seiki M, Tanaka S: Negative regulation of osteo-clastogenesis by ectodomain shedding of receptor activator of NF-kappa ... turnover markers alkaline phosphatase, osteocalcin and urinary deoxypyridinoline were positively associated with RANKL mRNA and/ or the RANKL/OPG mRNA ratio, which is consistent with these markers in...
- 9
- 410
- 0
Từ khóa: báo cáo y họcbáo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyencáo cáo y họcbáo cáo khoa học đề tài thử nghiêm nhân giống và nuôi dưỡng dế mèn gryllus assimilis trên địa bàn tỉnh quảng bìnhobesity is associated with a high prevalence of erectile dysfunction; howeverwhich type of cloud is associated with fair weatherwhich of the following is associated with fair weatherwhat indian tribe is associated with the trail of tearswhat type of weather is associated with stratocumulus cloudswhat kind of weather is associated with altostratus cloudswhat kind of weather is associated with nimbostratus cloudsNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM