Báo cáo khoa học: "F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters" pdf

... al.:18F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters. Radiation Oncology ... volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parametersChia-Hung Kao1,3, Te-Chun Hsieh1,5, Chun-Yen Yu2,5, Kuo-Yang ... Cidda C,D’Avenia P, Fattori S, Montini GC, Valentini G, Proietti A, Algranati C: Radiotherapy planning: PET/CT scanner performances in the definition of gross tumour volume and clinical target volume. ...

Báo cáo khoa học: "Early clinical experience with volumetric modulated arc therapy in head and neck cancer patients" ppsx

... Shrivastava SK, Mahantshetty U, Engineer R,Deshpande DD, Jamema SV, Vanetti E, Clivio A, Nicolini G, Fogliata A: A treatment planning study comparing volumetric arc modulation withRapidArc and ... Switzerland.Authors’ contributionsMS and AF coordinated the entire study. Patient accrual and clinical datacollection was done by MS, SC, CB, MB, PN, SP. Data analysis, physics data and treatment ... FDG-PET imaging whenever available) plus a margin for microscopic spread, and the low-risk Clinical Target Volume (CTV2) included precautionally uninvolvednodes. A margin for Planning Target Volume...

Báo cáo khoa học: "Gemcitabine/cisplatin versus 5-fluorouracil/ mitomycin C chemoradiotherapy in locally advanced pancreatic cancer: a retrospective analysis of 93 patients" pptx

... Hinke A, Louvet C: Increased survival usingplatinum analog combined with gemcitabine as compared to single-agent gemcitabine in advanced pancreatic cancer: pooled analysis oftwo randomized trials, ... gemcitabine and radiotherapy for locally advanced pancreatic cancer. IntJPancreatol2001, 29(1):9-18.21. Eppinga W, Lagerwaard F, Verbakel W, Slotman B, Senan S: Volumetricmodulated arc therapy for advanced ... Martenson JA,Camoriano JK, Stella PJ, Tenglin RC, Schaefer PL, Moore DF Jr, Alberts SR:Gemcitabine, cisplatin, and radiotherapy for patients with locallyadvanced pancreatic adenocarcinoma:...

Báo cáo khoa học: "Mixed germ cell tumor metastatic to the skin: Case report and literature review" pptx

... of an internal malignancy israre, with an incidence of 2.9-9%[1,2]. The frequenciesof skin metastases in females are 69% for breast cancer,9% for colon cancer, and 5% for melanoma. In malesthe ... typically an asymptomatic enlarged testicle. The retroperitoneum is the most common metastaticarea. Other metastatic sites include the lung, liver, brain, adrenal glands, gastrointestinal tract and ... Karaduman A, Bukulmez G, Sahin S, Ozkaya O, Erkan I: Renal cellcarcinoma with skin metastasis. J Eur Acad Dermatol Venereol 2004,18:386-7.8. Saeed S, Keehn CA, Morgan MB: Cutaneous metatasis:...

Báo cáo khoa học: "Taurolidine reduces the tumor stimulating cytokine interleukin-1beta in patients with resectable gastrointestinal cancer: a multicentre prospective randomized trial" doc

... IL-1alpha protein production in human and animal cancer cell lines including sarcomas and ovarian and transitional cell carcinomas. The exact mechanismsby which IL-1 promotes tumor growth remain ... remaining of the intraperitoneal fluid was col-lected to determine intraabdominal viable tumor cells (in T1 and T4). The volume of the removed material was 30ml in all measurements and standardized ... 13:1021-1025.4. Braumann C, Ordemann J, Kilian M, Wenger FA, Jacobi CA: Local and systemic chemotherapy with taurolidine and taurolid-ine/heparin in colon cancer-bearing rats undergoing laparot-omy. Clin...

Báo cáo khoa học: "SemiClinical application of tumor volume in advanced nasopharyngeal carcinoma to predict outcome" pptx

... All images were e valuated by two clinicians atleast. A radiologist who specialized in head and neck cancer participated when the outline of tumor marginwas unclear. Radiotherapy An intensity-modulated ... at high frequency in Southern China, Hong Kong, Taiwan, Singapore, and Malaysia [1]. Radiotherapy has long been the standardtreatment for patients with NPC because of its anatomiclocation and ... widely available. Tumor volume definition and measuring protocols should bestandardized in clinical practice. Lee et al. had tried touse simple measurement to evaluate of primary tumor volume and...

Tài liệu Báo cáo khoa học: "Automatic Extraction of Lexico-Syntactic Patterns for Detection of Negation and Speculation Scopes" pdf

... Fast exact infer-ence with a factored model for natural language pars-ing. Advances in neural information processing sys-tems, pages 3–10.D. McClosky and E. Charniak. 2008. Self-training for biomedical ... Journal of biomedical informatics,34(5):301–310. A. B. Clegg and A. J. Shepherd. 2007. Benchmark-ing natural-language parsers for biological applica-tions using dependency graphs. BMC bioinformatics,8(1):24.M.C. ... parsed each sentence in the trainingdataset which contained a negation or speculationcue using the Stanford parser (Klein and Manning,2003; De Marneffe et al., 2006). Figure 1 shows theparse...

Báo cáo khoa học: Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation potx

... Takashi Osaka, Reiko Sakamoto, Akinori Tokunaga,Yuhki Nakatake, Mitsuharu Sato and Nobuaki YoshidaLaboratory of Developmental Genetics, Center for Experimental Medicine and Systems Biology, Institute ... FAC-SCalibur (Becton Dickinson, Franklin Lakes, NJ, USA) and flowjo software (TreeStar, Ashland, OR, USA).Mice and teratoma formationC57BL ⁄ 6J mice and MCH:ICR mice were purchased fromCLEA Japan ... postnatal mouse brain.Mech Dev 101, 217–220.22 Mitsui K, Tokuzawa Y, Itoh H, Segawa K, MurakamiM, Takahashi K, Maruyama M, Maeda M & Yama-naka S (2003) The homeoprotein Nanog is required for maintenance...

Báo cáo khoa học: Stimulation of ﬁbroblast proliferation by neokyotorphin requires Ca2+ inﬂux and activation of PKA, CaMK II and MAPK/ERK pdf

... colorectaltumors on mitogen-activated protein ⁄ extracellularsignal-regulated kinase kinase ⁄ extracellular signal-regulated kinase and nuclear factor kappaB pathway and cellular transformation. Cancer ... system. PKA may activatethe Ca2+L-type channel, resulting in an increase in the Ca2+ in ux, elevation of the intracellular Ca2+level and CaMK II activation. A generalized schemeof the action ... activates a Rap1 and B-Raf signaling pathway via the cyclic adenosine mono-phosphate-dependent protein-kinase. J Biol Chem 275,3722–3728.42 Dumaz N & Marais R (2005) Integrating signalsbetween...

Báo cáo khoa học: Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site pptx

... for mutagenesis were as follows:LmS12 2A (F), CTTGGCTGCTTGCGAGCTGTTATTCTTTTCAATCC; LmS12 2A (R), GGATTGAAAAGAATAACAGCTCGCAAGCAGCCAAG; LmA105S (F), TTGACAGAACTGGTATCAAAGATGAGAGAAATG; LmA105S(R), ... CTCGAGAACCATGGAAGACGCCAAAAACATAAAG; KZKLUC1 (F), CTCGAGAACAATGGAAGACGCCAAAAACATAAAG. The boldletters in the primers show Kozak sequence.The luciferase reporter gene with the Kozak sequence wasthen ... CAGATCGATGTGAAAATGATGCAATTAGCAGTTC; Lm V123I (F), TGGCTGCTTGCGATCTATTATTCTTTTCAATCC; Lm V123I(R), GGATTGAAAAGAATAGATCGCAAGCAGCCA.Screening of LmRXR mutants in tobaccoprotoplastsThe LmRXR mutants...

Xem thêm