Báo cáo y học: "Catabolic stress induces expression of hypoxia-inducible factor (HIF)-1α in articular chondrocytes: involvement of HIF-1α in the pathogenesis of osteoarthritis" ppt
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"
... Lee JY, et al. Vacuolating cytotoxin in Helico-bacter pylori water-soluble proteins upregulates chemokine expression in human eosinophils via Ca2+ influx, mitochondrial reactive oxygen intermediates, ... i n v i t r o and in vivo. Moreo-ver, Hp induces genomic instability in nuclear CA repeats in mice and in mtDNA of AGS cells and chronic gastritis tissue, and this effect in mtDNA is associated ... increase the mtDNA mutation in AGS cells a nd mtDNA mutations have been found in Hp infected gastric ulcer and carcinoma tissues [12,13]. However, the role of ROS in the Hp induced mtDNA mutations...
- 12
- 557
- 2
Báo cáo Y học: Molecular cloning, bacterial expression and properties of Rab31 and Rab32 docx
... a long form of Rab32 (see Discussion). Bacterial expression of Rab31 and Rab32 GSTRab31, GSTRab32 and the potentially GTPase-deđcient mutants of t hese proteins, GST Rab31 Q64L and GST±R ab32Q85L, ... only Rab31 and not GST, GST Rab32 orGST±Rab5A (Fig. 7C). Similarly, antibody to Rab32 detected only Rab32 (and minor proteolytic fragments)(Fig. 7D).[35S]GTP[S] binding by GST Rab31 and ... membrane [45].Binding of guanine nucleotides and hydrolysis of GTPby GST Rab31 and GST Rab32 Many studies have shown that bacterially expressed R abproteins, devoid of post-translational modiđcations,...
- 13
- 481
- 0
Báo cáo khoa học: Oxidative stress induces a reversible flux of cysteine from tissues to blood in vivo in the rat pptx
... disulfide bal-ance of these organs, and whether cysteine efflux to the blood was paralleled by a change in the Cysconcentration in other tissues. Diamide, at 60 min from the start of administration, ... increase in the concentration of total cysteine showed an almost linear dose dependence, asshown in Fig. 6, in which the maximum total cysteine accumulated in RBCs and plasma is plotted against the ... GSH. An increase in liverGSH after an acute increase of circulating cysteine hasbeen described previously [43].Maintenance of an adequate plasma thiol–disulfidebalance appears to be fundamental....
- 13
- 510
- 0
Báo cáo Y học: CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) doc
... CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) Gen Yosimichi1,2, ... Yosimichi1,2, Tohru Nakanishi1, Takashi Nishida1,3, Takako Hattori1, Teruko Takano-Yamamoto2 and Masaharu Takigawa1,31Department of Biochemistry and Molecular Dentistry, and 2Department of Orthodontics, ... serum.In vivoMAP kinase luciferase assayERK phosphorylation was quantified using an MAPKin vivo kinase assay kit and p38K in vivo kinase assay kit(Clontech) according to the manufacturer’s protocol....
- 8
- 377
- 0
Báo cáo y học: "IL-17 induces production of IL-6 and IL-8 in rheumatoid arthritis κ synovial fibroblasts via NF-κB- and PI3-kinase/Akt-dependent pathways" doc
... of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF- κ B- and PI3-kinase/Akt-dependent pathwaysSue-Yun Hwang1, Ju-Young Kim1, Kyoung-Woon Kim1, Mi-Kyung Park1, Youngmee ... signaling in human monocytecell line [10] and embryonic fibroblasts [11], respectively, and yet cytoplasmic players transmitting IL-17-mediatedactivation in RA synovial fibroblasts remain to be investi-gated. ... IL-17-mediated induction of IL-6 and IL-8 in RA FLS with the effects of other pro- and anti-inflammatory cytokines. As shown in Fig. 3a, IL-17 inducedthe production of IL-6 as strongly as did IFN-γ and...
- 9
- 411
- 0
Báo cáo y học: "Psychological stress and fibromyalgia: a review of the evidence suggesting a neuroendocrine link" pps
... Bradley LA, Alarcon GS, Triana-Alexander M, AlexanderRW, Martin MY, Alberts KR: Perceived physical and emotionaltrauma as precipitating events in fibromyalgia. Associationswith health care ... (ACTH) from the anterior Review Psychological stress and fibromyalgia: a review of the evidence suggesting a neuroendocrine linkAnindya Gupta and Alan J SilmanARC Epidemiology Unit, School of Epidemiology ... symptoms of the fibromyalgia syndrome. Although these systems are clearlyinterconnected, the review will consider separately the potential role of the hypothalamic–pituitary–adrenal (HPA)axis, the...
- 9
- 462
- 0
Báo cáo y học: "Catabolic stress induces expression of hypoxia-inducible factor (HIF)-1α in articular chondrocytes: involvement of HIF-1α in the pathogenesis of osteoarthritis" ppt
... radicals) may induce the expression of HIF-1α in articular chondrocytes. IL-1 has beenshown both to inhibit chondrocyte anabolic activity, including the down-regulation of proteoglycan synthesis, ... support the idea thatFigure 3Catabolic factors induce the expression of HIF-1α protein in human articular cartilageCatabolic factors induce the expression of HIF-1α protein in human articular ... stabi-lization of HIF [39]. Our results of catabolic stress- induced expression of HIF-1α in chondrocytes are consistent withthese findings. These findings suggest that HIF-1α may, atleast in part,...
- 11
- 385
- 0
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot
... activation and aggrecan and collagen release.Materials and methods Cartilage degradation assayBovine nasal cartilage was cultured as previously described[20]. Briefly, bovine nasal septum cartilage ... ATATTTATACGCCTTTTGATTCCT 297GGTACCCGTAGAGCTTCCGTTCCα2M GCCCGCTTTGCCCCTAACA 359TCGTCCACCCCACCCTTGATGRECK GTAATTGCCAAAAAGTGAAA 352TAGGTGCATATAAACAAGAAGTAADAMTS-1 GCTGCCCTCACACTGCGGAAC 264CATCATGGGGCATGTTAAACACADAMTS-4 ... 287AATAGCTTTACGGGTTTCAGGTIMP-1 TGGGCACCTGCACATCACC 277CATCTGGGCCCGCAAGGACTGTIMP-2 ATAGTGATCAGGGCCAAAGCAGTC 277TGTCCCAGGGCACGATGAAGTCTIMP-3 GATGTACCGAGGATTCACCAAGAT 356GCCGGATGCAAGCGTAGTTIMP-4 ATATTTATACGCCTTTTGATTCCT...
- 12
- 526
- 0
Báo cáo y học: "Catabolic cytokine expression in degenerate and herniated human intervertebral discs: IL-1β and TNFα expression profile Christine Lyn Le Maitre, Judith Alison Hoyland and Anthony J Freemont" ppsx
... articleCatabolic cytokine expression in degenerate and herniated human intervertebral discs: IL-1β and TNFα expression profile Christine Lyn Le Maitre, Judith Alison Hoyland and Anthony J FreemontTissue ... the first interleukin-1 inhibitor in the treatment of rheumatoid arthritis. Int J Clin Pract 2003,57:231-234.33. Le Maitre CL, Freemont AJ, Hoyland JA: A preliminary in vitrostudy into the ... Hoyland JA: Localization of degrada-tive enzymes and their inhibitors in the degenerate human intervertebral disc. J Pathol 2004, 204:47-54.6. Sive JI, Baird P, Jeziorsk M, Watkins A, Hoyland...
- 11
- 261
- 0
Báo cáo y học: "IL-23 induces human osteoclastogenesis via IL-17 in vitro, and anti-IL-23 antibody attenuates collagen-induced arthritis in rats" ppt
... 4Inhibition of IL-23-induced osteoclastogenesis by osteoprotegerin, anti -IL-17 antibody, and etanerceptInhibition of IL-23-induced osteoclastogenesis by osteoprotegerin, anti -IL-17 antibody, and ... showed that IL-23 induced keycytokines such as IL-17 and IFN-γ and that IL-23 induced human osteoclastogenesis via these cytokines (Figure 9). Ourfindings indicate that loss of the IL-17/ IFN-γ balance ... indicating that IL-23 is necessary to induceinflammation and osteoclastogenesis even after the onset ofclinical arthritis. Staining of synovial tissues with hematoxylin and eosinshowed that treatment...
- 12
- 210
- 0
Báo cáo y học: "Candida albicans induces cyclo-oxygenase 2 expression and prostaglandin E2 production in synovial fibroblasts through an extracellular-regulated kinase 1/2 dependent pathway" pps
... albicans infection of prostaglandin E2 (PGE 2 ) production by synovial fibroblastsThe effect of Candida albicans infection of prostaglandin E2 (PGE 2 ) production by synovial fibroblasts. Synovial ... evaluated by an electrophoretic mobility shift assay.Results Infection of synovial fibroblasts with C. albicans resulted in cyclo-oxygenase 2 expression and prostaglandin E2 production. Cyclo-oxygenase ... and phosphorylated extracellular-regulated kinase 1 /2. Conclusions C. albicans infection of synovial fibroblasts in vitroresults in upregulation of cyclo-oxygenase 2 and prostaglandin E2 by mechanisms...
- 9
- 403
- 0
Báo cáo y học: " HIV-1 transgene expression in rats causes oxidant stress and alveolar epithelial barrier dysfunction" doc
... previously identified in HIV-1 transgene expression impaired alveolar epithelial barrier function in vivo and increased permeability of alveolar epithelial monolayers in vitroFigure 3 HIV-1 transgene ... HIV-1 transgene expression in rats on alveolar epithelial barrier function. Alveolar epithelial barrier function was assessed by determining lung liquid clearance in vivo and alveolar epithelial monolayerpermeability ... pro-teins in vivo.Discussion In this study we determined that HIV-1 transgene expres-sion in rats, in which HIV-related proteins includinggp120 and Tat are expressed in the absence of viral infec-tion...
- 12
- 334
- 0
Báo cáo y học: "Peptidyl arginine deiminase type IV (PADI4) haplotypes interact with shared epitope regardless of anti-cyclic citrullinated peptide antibody or erosive joint status in rheumatoid arthritis: a case control study" doc
... responsibility for the integrity of the data and the accuracy of the data analysis. Bang and Bae participated in the study design, acquisition of data, analysis and interpretation of data, statis-tical aspects, ... Burmester GR, Salama A, Dorner T: Detailed analysis of the variability of peptidylarginine deiminase type 4 in German patients with rheumatoid arthritis: a case- control study. Arthritis Res ... Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine A, Iida A, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto K: Functional haplotypes of PADI4,...
- 9
- 174
- 0
Báo cáo y học: " Cryptococcus neoformans induces IL-8 secretion and CXCL1 expression by human bronchial epithelial cells" doc
... purposes)Respiratory ResearchOpen AccessResearch Cryptococcus neoformans induces IL-8 secretion and CXCL1 expression by human bronchial epithelial cellsLoïc Guillot1, Scott F Carroll1,2, Mohamed Badawy4 ... genes by C. neoformans in human BEAS-2B cells using an oligonucleotide microarray and confirmed the hybridization data by conventional and real-time PCR for CXCL1 and CEBP/β. CXCL1 has already beenshown ... Quantitative analysis of phagocytosis and killing of Cryptococcus neoformans by human peripheral bloodmononuclear cells by flow cytometry. Clin Diagn Lab Immunol1995, 2(6):753-759.22. Ishikawa Y, Mukaida...
- 12
- 304
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ