Báo cáo khoa học: "Novel deployment of a covered duodenal st

Báo cáo khoa học: "Novel deployment of a covered duodenal stent in open surgery to facilitate closure of a malignant duodenal perforation" ppt

... Access Case report Novel deployment of a covered duodenal stent in open surgery to facilitate closure of a malignant duodenal perforation Philip F Lung, Adrian B Cresswell, Josephine Psaila and Ameet ... complications in a locally advanced intra abdominal malignancy. Case presentation: A 38 year old Vietnamese man presented with a carcinoma of the col...

Ngày tải lên : 09/08/2014, 04:21

3
217
0

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspeciﬁc alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... 1827–1834. 17 Cai G, Michigami T, Yamamoto T, Yasui N, Satomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S & Ozono K (1998) Analysis of localization of mutated tissue-nonspeciﬁc alkaline ... Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocrine Rev 15, 439–461. K. Komaru et al. Novel aggregate formation of an alkaline phosphatas...

Ngày tải lên : 19/02/2014, 17:20

14
445
0

Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identiﬁcation ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

... chromatography; 5, proteins not bound to immobilized lactoferrin binding site (final fraction). (E) Analysis of fractions obtained from the preparative EMSA and DNA affinity chromatography stages ... general rules for siRNA selection [43]. The first siRNA ZF5 5¢-GGUUGAGGAUGUGAAAUUCUU-3¢ and 5¢-GAAUUUCACAUCCUCAACCUU-3¢) matched bases 192–210; the second siRNA ZF5 (5¢-GAGGAAGCAUGA GAAACUCUU-3¢...

Ngày tải lên : 07/03/2014, 05:20

15
472
0

Báo cáo khoa học: Novel a-conotoxins from Conus spurius and the a-conotoxin EI share high-afﬁnity potentiation and low-afﬁnity inhibition of nicotinic acetylcholine receptors doc

... superfamily, containing several jI-conotoxins, and the A superfamily, containing a- conotoxins, aA-conotoxins and jA-conotoxins [1]. Competitive antagonists of the nicotinic acetylcholine receptors (nAChRs) ... superfamily, containing r-conotoxins and aS-conotoxins; the T superfamily, containing e-conotoxins and v-conotoxins; the P superfamily, containing the spasmodic peptides; the I...

Ngày tải lên : 16/03/2014, 11:20

14
532
0

Báo cáo khoa học: Novel dissociation mechanism of a polychaetous annelid extracellular haemoglobin pptx

... Ebina S, Matsubara K, Nagayama K, Yamaki M & Gotoh T (1995) Carbohydrate gluing, an architectural mechanism in the supramolecular structure of an annelid giant hemoglobin. Proc Natl Acad ... following observa- tions, namely (a) the decrease of the A 414 : A 280 of each elution peak, which is characteristic of a loss of haem and (b) the increasing formation of nonhaem...

Ngày tải lên : 23/03/2014, 10:21

15
304
0

báo cáo khoa học: " Novel surgical technique for complete traumatic rupture of the pancreas: A case report" potx

... lay open after the hematoma was removed. PT: pancreatic tail; PV: portal vein; S: stomach; SV: splenic vein. (C) This photograph was taken after the tail of the pancreas (PT) was anastomosed as ... anastomosis and an inner duct -to- mucosa anastomosis. The outer layer was prepared by placing U-shaped transpancreatic st itches to the dorsal part of the jejunum while carefully avoidin...

Ngày tải lên : 10/08/2014, 23:20

3
717
0

Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

... 818–823. 69 Inouye S, Fujimoto M, Nakamura T, Takaki E, Hayashida N, Hai T & Nakai A (2007) Heat shock transcription factor 1 opens chromatin structure of interleukin-6 promoter to facilitate binding ... 2087–2099. 40 Nakai A, Tanabe M, Kawazoe Y, Inazawa J, Morimot- o RI & Nagata K (1997) HSF4, a new member of the human heat shock factor family which lacks properties of...

Ngày tải lên : 18/02/2014, 04:20

10
565
0

Báo cáo khoa học: Novel modiﬁed version of nonphosphorylated sugar metabolism – an alternative L-rhamnose pathway of Sphingomonas sp. doc

... Watanabe S, Shimada N, Tajima K, Kodaki T & Maki- no K (2006) Identiﬁcation and characterization of L-arabonate dehydratase, L-2-keto-3-deoxyarabonate dehydratase and L-arabinolactonase involved ... shown in Fig. S2). Among them, FAH catalyzes the hydrolytic cleavage of a C–C bond in fumarylacetoacetate to yield fumarate and acetoacetate, and the catalytic reaction is partiall...

Ngày tải lên : 16/03/2014, 04:20

14
329
0

Báo cáo khoa học: Novel aspects of calmodulin target recognition and activation pptx

... which causes a conformational change and enables Ca 2+ /CaM to bind to speciﬁc CaM-binding domains. The binding of Ca 2+ /CaM to its target proteins alters their activity in a calcium dependent manner. The ... the Ca 2+ -pump. Keywords: calmodulin; CaM-binding domains; Ca 2+ - signaling; cellular signaling; CaM-target activation. Ca 2+ signaling and calmodulin The calcium metal...

Ngày tải lên : 17/03/2014, 09:20

11
316
0

Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

... Datla 2, *, Akshaya Bellary 1, *, Khalander Basha 1 , Ashwani Sharma 1 , Anuradha Sharma 1 , Shiva Singh 1 , Shakti Upadhyay 2 and Vikram Rajagopal 1 1 Drug Discovery and Development Group, Reliance ... the cDNA was carried out using the respective gene-speciﬁc primers: ICAM-1 5¢- CTGATGGGCAGTCAACAGCTAAAA - 3¢(sense) 5¢- TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense) Cox-2 5¢-ATGAGATTGTGGGAAAATTGCT...

Ngày tải lên : 22/03/2014, 21:20

14
202
0