Báo cáo y học: "The expansion of CD4+CD28– T cells in patients with rheumatoid arthritis" potx
Báo cáo y học: "The expansion of CD4+CD28– T cells in patients with rheumatoid arthritis" potx
... cells was in RA patients with limited joint manifestations. Signif-icantly higher numbers of CD28–lymphocytes werepresent in patients with advanced joint involvement andextra-articular manifestations.The ... factor of vasculitis manifestations in patients with RA [20].The accumulation of NK-receptors expressing CD4 cells in synovial tissue is compatible with a direct contribution of these cells to ... manifestations.The association of CD4+CD28– T cells with diseasestatus has given rise to the hypothesis that these cells directly contribute to disease manifestations. Patients with nodulosis and extra-articular...
- 4
- 399
- 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot
... othersobserved that this cytokine protected T cells from apopto-sis [50,51]. We favor the hypothesis that TGF-β promotesthe death of mature Th1 and Th2 cells while protectingnewly generated regulatory T ... activating them with TGF-β. An adoptiveimmunotherapy using the patients own T cells that haveregained a protective function they had lost should lack theserious toxic effects associated with ... their TCRs. They inhibit the activation of other T cells by a contact-dependent mechanism [5–17]. Alarge percentage constitutively express intracellular cyto-toxic T- lymphocyte-associated antigen...
- 6
- 408
- 0
Báo cáo y học: "High frequency of corticosteroid and immunosuppressive therapy in patients with systemic sclerosis despite limited evidence for efficacy" doc
... committee of theCologne University Hospital and by the respective ethics com-mittee of the centers.By August 2007 more than 1,729 patients had been regis-tered in the database. Patients with the ... guidelines.To this end, treatment was analyzed in patients whose datawere recorded in the registry of the DNSS. The patient popu-lation comprises patients of the clinical centers specializing in the ... KerstinSteinbrink (Department of Dermatology, University of Mainz,Germany), Annegret Kuhn (Department of Dermatology, Uni-versity of Münster, Germany), Merle Haust (Department of Dermatology, University...
- 10
- 499
- 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf
... alter the binding mode and affinity of theenzyme for PAA and derivatives thereof, while maintainingthe hydrophobicity of the binding site.To test the effect of the mutations on the specificity ... aF146, yielded mutants that were changed with respect to both activity and interaction with the deacylatingnucleophiles.The above indicates that the relative rates of hydrolysisand synthesis ... effect of the mutations on theacylation rate indicate that these residues are necessary forcorrect positioning of the substrate in the active site with respect to the catalytic residues.Transferase/hydrolase...
- 8
- 561
- 0
Báo cáo y học: "The role of tumor necrosis factor-alpha in systemic lupus erythematosus" pdf
... oninfliximab therapy in SLE suggests that, in combination with azathioprine, infliximab may turn out to be an interestingtherapeutic option in selected patients with SLE and in particular in those ... as the kidney, the joints, orthe skin. However, in view of the autoimmunogenic potential of inhibiting TNF, we tested TNF inhibition as a means tointerfere with the inflammatory response in ... regulation of the two cytokines is notfunctional in active SLE. Rather, the combined increase of both TNF and IFN-α might contribute to the pathogenesis of systemic autoimmunity.Another hypothesis...
- 8
- 464
- 0
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt
... by the levels of staining with anti-CD27 and anti-CD38, as determined by staining with a relevant isotype control. Using this combination of stains, B cells can be divided into naïve transitional ... of the University of Toronto and is the recipient of The Arthritis Society/CIHR Investigator Award. Dr Fortin is funded by an Investigator Award from The Arthritis Society/CIHR Institute of ... correlation between the proportion of total NKT cells and disease activity or drug therapy in ourlupus patients, which suggests that the reduction in NKT cells in these patients does not arise...
- 13
- 451
- 0
Báo cáo y học: "Simultaneous transcription of duplicated var2csa gene copies in individual Plasmodium falciparum parasites" potx
... (IT/FCR3)PFDG_01326.1 (Dd2)TTGTGGTGA TGGTAGTGTCACTGGTAGTGGTAGTAGTTTTGTGGTGA TGGTAGTGTCACTGGTAGTGGTAGTAGTTTAGTGGTGA TGGTAGTGTCACTGGTAGTGGTAGTAGTTTA A TGC TGA TGG TAG TGTCA C TGG TA G TGG TA ... AAATTAATGGGAACTACATTTGTTGTAGTTGTTGCCA TGGC AA A T TA A TGGGA A C TA CA T TTG T TG TA GT TGTTGCCA TGGC AAA TTAA TGGGAAC TACA TT TGT TGTAGTTGT T T T TTGACTGACTGACTGAC T T T TTGACTATGACTATGACTATGACTATTTGAACAAAAGATTTGAACAAAAGATTTGAACAAAAGATTTGAACAAAAGA ... TGTAGTTGT T T T TTGACTGACTGACTGAC T T T TTGACTATGACTATGACTATGACTATTTGAACAAAAGATTTGAACAAAAGATTTGAACAAAAGATTTGAACAAAAGA TGCCATGGC AAATTAATGGGAACTACATTTGTTGTAGTTGTTTTGAACAAAAGA TGCAATGGC AAATTAATGGGAACTACATTTGTTGTAGTTGTTTTGAACAAAAGA TGCAATGGC AAATTAATGGGAACTACATTTGTTGTAGTTGTTT...
- 16
- 239
- 0
Báo cáo y học: "Trace Elements, Heavy Metals and Vitamin Levels in Patients with Coronary Artery Diseas"
... be increased in patients with CAD. These findings need to be further investigated in larger well designed studies. Conflict of Interest The authors have declared that no conflict of in- terest ... among patients with CAD having no history of Pb exposure in literature. In the present study, it was found that mean levels of serum Pb tended to be higher in CAD patients. We found that mean ... pa-tients having normal coronary arteries attending car-diology clinic at Yuzuncu Yil University Hospital. The study was approved by the local ethics committee according to the declaration of...
- 5
- 527
- 0
Báo cáo y học: " Sigma-1 receptor agonist fluvoxamine for delirium in patients with Alzheimer’s disease pot
... conceived of the study and participated in its study andcoordination. Both authors read and approved the final manuscript.Competing interestsThe authors declare that they have no competing interests.Received: ... serious acute neuropsychiatric syndrome, with corefeatures of inattention and global cognitive impairment. Although antipsychotic drugs are the me dications mostfrequently used to treat this syndrome, ... suggesting that sigma-1 receptors might play arole in the mechanism of action of fluvoxamine [7].Given the role of sigma-1 receptors in the regulation of neurotransmitter systems, we hypothesised...
- 3
- 351
- 0
Báo cáo y học: "Switching from serotonin reuptake inhibitors to agomelatine in patients with refractory obsessive-compulsive disorder: a 3 month follow-up case series" doc
... refractory to previous treatments with SRIs, with and without other psychiatric comorbidities. At theend of the treatment, three out of six patients showed aclinical improvement with a symptom ... wasassociated to refractoriness to agomelatine within3 months of 50 mg/day therapy. This appears to be con-sistent with evidence in the current literature pointingout a lack of response to antidepressants ... and to a num-ber of eventually concomitant clinical features, mainlyreferabletobipolarity[9],whichmayaccountforsome of the treatment-refractory cases.Within the past few years, greater attention...
- 8
- 465
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ