Báo cáo khoa học: "Prevalence and demographics of anxiety disorders: a snapshot from a community health centre in Pakistan" ppsx

... found between anxiety and marital status (p =0.342). Similarly, no association between anxiety and family income, and anxiety and occupational statusexisted. In the final multivariate model, only ... hospital clinic in Kara-chi, Pakistan. J Pak Med Assoc 2006, 56(5):243-247.24. Winkvist A, Akhtar H: Images of health and health care optionsamong low income women in Punjab, Pakistan. In Soc ... reportedthat using cut-off score of ≥ 8 on HADS -A, GAD wasdetected with a sensitivity of 0.89 and a specificity of 0.75[19].Statistical analysisData was double entered and analyzed in Statistical...

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... C)AATTTC-3¢ PsCBL (degenerate forward)45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse)55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward)65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR ... T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward)25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse)35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL ... AAR01663) and AtCBL3(AAM91280). The calcium binding domains (EF1–4) and calcineurin A binding domain are shown in the box. The dot in the EF1 box repre-sents the modiﬁed amino acids alanine (A) as...

báo cáo khoa học: " Prevalence and consequences of patient safety incidents in general practice in the Netherlands: a retrospective medical record review study" potx

... D, Marineau D, et al:Patient safety in the ambulatory setting. A clinician-based approach. JGen Intern Med 2004, 19(7):719-725.11. Sandars J, Esmail A: The frequency and nature of medical error ... most of their medical care in general practice, but to date adequate data on theprevalence of patient safety incidents in general practiceare not available [2,3]. In the Netherlands, all citizensare ... [13].Sample of patients and practices A stratified sample of general practices in the Nether-lands was adopted in order to obtain a nationally repre-sentative sample with regard to practice...

báo cáo khoa học: " Prevalence and correlates of HIV, syphilis, and hepatitis B and C infection and harm reduction program use among male injecting drug users in Kabul, Afghanistan: A cross-sectional assessment" ppsx

... and marginally associated with initiating injecting outsideAfghanistan (Table 2). HCV Ab was independently asso-ciated with initiat ing inject ing outside Afghanis tan, everhaving an abscess, ever sharing ... this article as: Todd et al.: Prevalence and correlates of HIV,syphilis, and hepatitis B and C infection and harm reduction programuse among male injecting drug users in Kabul, Afghanistan: A ... at enrollment was associated withprior incarceration, initiating drug u se with injecting,frequency of daily injection, sharing of injecting worksinthepriorthreemonths,andmarginallywithbeinghomeless...

Báo cáo khoa học: " Prevalence and incidence of severe sepsis in Dutch intensive care unit" pdf

... incidence of diseasessuch as coronary heart disease and cerebrovascular accident,but it is comparable with the incidence of breast cancer, lungcancer and Parkinson's disease in The Netherlands. ... the estimated length of stay, and the capacity of the participating ICUs relative to thenational intensive care capacity.Results The participating ICUs had 442 beds available for admissions, ... sepsis in 5878 consecutiveICU patients admitted to Australian and New Zealand ICUs.Figure 1Failing organ systemsFailing organ systems. Histogram of the number of failing organ sys-tems in prevalent...

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... and ACCAGCTGGGCCAACATTTC; collagen III:TGGACAGATGCTGGTGCTGAG and GAAGGCCAGCTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGGAGCCATTGTCACACAC; and glyceraldehyde-3-phosphatedehydrogenase: ... CACGAG-3¢;TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTACCACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCCACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAACCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTTCAA and ACCAGCTGGGCCAACATTTC; ... cardiac ﬁbrosis in a paracrine manner under ischaemic conditions.Taken together, these ﬁndings may improve understanding of the cellu-lar and molecular basis of the anti -in ammatory and paracrine...

Báo cáo khoa học: "Characterization and localization of the unique Marek''''s disease virus type 2 ORF873 gene product" ppsx

... using the primers 5'-CCGCGATCGATGAACATTTCGAATTA-3' (ORF873F) and 5'-CGCTCTAGACTACTGTTCACTCGTAT-3' (ORF873R),which created PstI and XbaI sites (underlined) on the 5' ... obtained from Sf9 cells and designated as rAcORF873. As a negativecontrol, the baculovirus recombinant cAcNPV was preparedby cotransfection with the parent vector pVL1392 and BaculoGold-linearized ... streptomycin (100µg/ml). MDV2 (strain HPRS24) waspassaged in CEF cells at least 30 times prior to use in thisstudy.Preparation of immune sera against MDVAntisera against MDV2 (HPRS24) and HVT...

Báo cáo khoa học: "Simulation and comparison of silvicultural alternatives for even-aged Pinus pinaster Ait stands in Galicia (Northwestern Spain)" pps

... Optimizing thinning and rotation in a stand of Pinus sylvestris on a drained peatland site, Scand. J. For. Res.11 (1996) 182–192.[18] Miina J., Preparation of stand management modelsusing simulation ... specific treatment history using initialbasal area and age as explanatory variables [10]. Thus,the simulator allows the evaluation of a relatively widerange of silvicultural alternatives. In the ... hectare, thinningswere of moderate intensity and standard from below, and the rotation length was determined as a function of theculmination of the mean-annual volume increment(between 25 and...

báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

... ATGGTG CAA CAG CAG AAC CAA GAA A- 3’. The primersused for obtaining the single HA-tagged version wereCaNDR1-Forward 4 and CaNDR1-Reverse 2 (5’ -CTACAA CAG CAG AAC CAA GA-3’). PCR fragments ... were taken 7 daysafter inoculation. (b) and (c) Bacterial growth was monitored in planta by assaying leaf samples 0, 2, and 4 days post-inoculation. CaNDR 1a- expressing lines (T3-1, T3-2 and T3-3), ... and 3’-ends of the PCR products, respectively: CaNDR1-Forward4, 5’-CACC ATG TAT CCC TAC GAC GTA CCA GATTAT ATG TC AGA CCC CAG CAG CAG TGC-3’ and CaNDR1-Reverse 3, 5’-CTA ATG GTG ATG GTG ATGGTG...

báo cáo khoa học: " Identification and characterisation of seed storage protein transcripts from Lupinus angustifolius" docx

... awareness in many societies of the escalatingincidence of obesity and the associated risk of diabetes and cardiovascular disease, NLL is an excellent candi-date as a healthy food.The major proteins ... human health food as the grain is high in protein and dietaryfibre, gluten-free and low in fat and starch and thus has a very low Glycaemia Index [1]. Like other legumes,lupin crops are an asset ... (L.), also known as narrow-leaf lupin (NLL) is a grainlegume crop that is gaining recognition as a potential human health food as the grain is high in protein and dietary fibre, gluten-free and...

Xem thêm