Báo cáo khoa học: "The Safety and efficacy of a new self-expandable intratracheal nitinol stent for the tracheal collapse in dogs" ppt

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a sialic acid speciﬁc lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... lectin on SDS/PAGE gave a singleband at apparent molecular mass of 34 kDa. The binding affinity of the lectin in the hemolymph of the freshwater crab, Paratelphusa jacquemontii, expressedO-acetyl ... showing a( 2–6) linkage. The sialic acid affinity of the Paratelphusa lectin wasfurther proved by its inability to inhibit sialidase-treatedBSM and bovine thyroglobulin. Also the lectin failed ... °C.HA assay was carried out to determine the presence of lectin in the fractions. The fractions that contained significantamount of lectin were pooled and dialysed against 1 mMCaCl2,at4°C for...

Báo cáo khoa học: Puriﬁcation and properties of a new S-adenosyl-Lmethionine:ﬂavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

... dianthramide-derivatives, the carnation phyto-alexins. However, no data are available regarding the role of this enzymatic activity in the biosynthesis of methylatedphenols other than the dianthramide-derivatives. ... isocratically, at a ﬂow rate of 1mLÆmin)1, and the volume of injected samples was 10 lL. The amounts of the residual initial phenolic substrate and the transformation product, derived from incubation ... (Vmax and Km) were determined with the Lineweaver–Burk plot method at a saturating concentration of AdoMet. Vmaxis expressed in lmolÆmin)1Æmg protein)1 and Km in lM. Assays to calculate...

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

... L-glutamate. The activity of L-aspartate was adjusted to 100.b30 mML-aspartatewas used as amino donor for a- ketoglutarate, and 30 mML-gluta-mate was used as amino donor for oxaloacetate. The activity ... respectively(Fig. 2C). In the paper chromatography analysis of amino acids (Fig. 3), the AATB3 also demonstrated the ability to transfer the a- amino of the l-tryptophanto a- ketoglutarate and oxaloacetate to ... (5¢-to3¢)P1GGTACCATGAATGATGCAGCAAAAG (KpnI)P2GAATTCTCAGCCTGATATTTCCGCCT (EcoRI)D232N-F CGTGCTCGTAAACGATGCGTATTACD232N-R ACAATCTCTTTGCCGGCCTCCGCK270H-F GGCGCGACGCACGAAAATTACGCK270H-R GTCTATTTTCACGCAAAGCACCCGGTR403Y-F...

Báo cáo khoa học: "The Safety and efficacy of a new self-expandable intratracheal nitinol stent for the tracheal collapse in dogs" ppt

... trachea to thoracic trachea.Fig. 1. Lateral radiographs before (a) and after (b) intratracheal placement of self expandable nitinol stent with flare ends in a dog with tracheal collapse. Collapsed ... located from the mid-cervical to the thoracic trachea increased the diameter of the entire cervical to thoracic tracheal area. Coughing and dyspnea disappeared and the dogs resumed normal activity. ... Joon-young Kim et al.Table 1. Effect of self expandable intratracheal nitinol stent on clinical signs in dogs with tracheal collapse Case Breed Age Sex Weight Grade of Stent size Site of stent ResultsNo....

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulﬁde reductase from methanogenic archaea pdf

... behavior istypical of integral membrane proteins. The polypeptide with anapparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1).Table 1. N-Terminal ... Materials and methods. (A) Data pointscorrespondtotheamplitudeofthetroughcenteredatg ¼ 1.951; as in the low po tential range, the radical signal of the dyes overlap in the g ¼ 2.0 region. The ... beendeposited in the databases. None of these putative pro teinshas b een c haracterized and no f unction has been assigned toany of them [2]. In this study, we chose the sulfate-reducingarchaeon A. ...

Báo cáo khoa học: Identiﬁcation and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... of A DNA binding domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and itsC-terminal extension. (B) Alignment of ligandbinding domain ... binding of SmNR1(Ile247-Ser372) and SmRXR1(Glu251-Asn376) in vitro. DNA binding of a protein containing 20 amino acids at the 5¢ end of the DBD, the DBD and the 40 amino acids at the 3¢ end of the ... DR2:5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCGTAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAAGGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGGTCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGTCATGACCTCG-3¢. One strand of each...

Báo cáo khoa học: Puriﬁcation and characterization of Helicobacter pylori arginase, RocF: unique features among the arginase superfamily doc

... 4).Activities of puriﬁed arginase and H. pyloriarginase-containing extracts with divalent cationsMammalian arginases require manganese for optimalcatalytic activity, although some of these arginases ... that RocF is neces-sary and sufﬁcient for arginase activity, and that the enzymehas a number of interesting and unique features among the arginase superfamily, including optimal enzymatic activitywith ... Bacillus licheniformis of the arginase and arginine deiminase routes of arginine catabolism and other factors a ecting their syntheses. J. Bacteriol. 135,920–927.25. Ramaley, R.F. & Bernlohr,...

Báo cáo khoa học: Puriﬁcation and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

... least six classes of cytosolic GSTs in insects [2]. The majority of GSTsare in the Delta and Epsilon classes, and the remain-ing enzymes are in the Omega, Sigma, Theta and Zetaclasses. The ... Corp., Carlsbad, CA,USA), in accordance with the manufacturer’s instructions.Removal of contaminating agents from the crude RNAextract was performed using a Qiagen RNeasy kit (Qiagen,Inc., Valencia, ... obtained by Edman degradation and LC ⁄ MS ⁄ MS analysis of the puriﬁed BgGSTD1 werecrucial for the isolation of cDNA. The N-terminalamino acid sequence provided essential information toindicate...

Báo cáo khoa học: Identiﬁcation and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans ppt

... 2957Identiﬁcation and characterization of a collagen-inducedplatelet aggregation inhibitor, triplatin, from salivaryglands of the assassin bug, Triatoma infestansAkihiro Morita1, Haruhiko Isawa2, ... a 2b1 and a IIbb3integrins and secretion of platelet agonists suchas ADP and thromboxane A 2, accelerating plateletaggregation and thrombus formation. Therefore, GPVIhas a central role in the initial phase ... or absence of 1.0 lM triplatin-1 and analyzed by anti-FcR c-chain(aFcR c-chain) and antiphosphotyrosine (aPY) immunoblotting. A. Morita et al. Identiﬁcation and characterization of triplatinFEBS...

Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

... explored the effects of combining activating and inactivating mutations of the TSHr within a single receptoron its constitutive activity towards Gs-alpha and Gq-alpha and its binding characteristics ... both for the cAMP and IP pathways. These data show that an inactive form of the TSHr which is trapped inside a cell after transfection is ableto gain the membrane surface when combined with anactivated ... transmembranehelices translates into an increased afﬁnity of the intracel-lular loops for G-proteins. Somatic and germline activatingmutations of the TSHr gene have been identiﬁed as a majorcause...

Xem thêm