Báo cáo khoa học: " Modulatory effects of chitosan adipate on the T and B lymphocyte subsets in mice" pps
Báo cáo khoa học: " Modulatory effects of chitosan adipate on the T and B lymphocyte subsets in mice" pps
... alt ="" < /b> alt ="" < /b> alt ="" < /b> alt ="" < /b> alt ="" < /b> ...
- 6
- 351
- 0
Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx
... GCCTGGCAGCTGGAAGACAAATAC ATGGCCAAAATCACAAGGGTTAGCABCC1 1119–1670 AGTGGAACCCCTCTCTGTTTAAG CCTGATACGTCTTGGTCTTCATCABCC4 3880–4124 TGATGAGCCGTATGTTTTGC CTTCGGAACGGACTTGACATABCC5 3692–3864 AGAGGTGACCTTTGAGAACGCA ... binding to the < /b> substrate-binding sites and < /b> not the < /b> nucleotide binding sites. The < /b> fact that quercetin inhibited MRP1-, MRP4- and < /b> MRP5-mediated transport in inside-out vesicleuptake and < /b> flow cytometry ... whichindicates that it stimulated ATPase activity at low con-centrations, whereas it inhibited the < /b> activity at higherconcentrations. The < /b> stimulatory effect suggests thatquercetin is likely to be...
- 16
- 517
- 0
Báo cáo khoa học: Focal localization of MukBEF condensin on the chromosome requires the flexible linker region of MukF docx
... mutations.These observations suggest that the < /b> defective detach-ment reaction, rather than the < /b> reduced ATPase activ-ity, is responsible for the < /b> phenotypic defects caused by the < /b> mutations. The < /b> ... activity of < /b> the < /b> MukB headWhile we were probing the < /b> mutational effects < /b> on < /b> the< /b> detachment reaction we unexpectedly noted that many of < /b> the < /b> mutations decreased the < /b> dimerization rate of < /b> the< /b> H C. Shin ... does not interact with the< /b> MukB head in the < /b> structure of < /b> the < /b> asymmetric dimer[21]. This D335A mutation did not affect the < /b> ATPaseactivity of < /b> the < /b> triple complex (not shown), indicatingthat the...
- 10
- 435
- 0
Báo cáo khoa học: "Early administration of IL-6RA does not prevent radiation-induced lung injury in mice" pot
... an important role in the< /b> synergistic induction of < /b> the < /b> SAA gene and < /b> the < /b> anti-IL-6receptor monoclonal antibody inhibits the < /b> synergisticinduction of < /b> SAA [21]. These findings indicate that IL-6RA ... beexplained by the < /b> fact that signal transduction of < /b> IL-1 orTNF-alpha is more strongly involved in the < /b> regulation of< /b> SAA production than that of < /b> IL-6 [25]. These findingssuggest that elevation of < /b> ... Additional work is neededto determine the < /b> optimal timing and < /b> duration for therapyusing this approach to the < /b> prevention of < /b> lung injury afterradiation therapy. Despite the < /b> negative findings of...
- 6
- 281
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... apotentially stabilizing S-H-N interaction (Fig. 9B) [49]. The < /b> above discussion rationalizes the < /b> observed effects< /b> of < /b> the < /b> Y74W mutation in PfTIM on < /b> the < /b> stability of < /b> the< /b> dimeric structure and < /b> catalytic ... sug-gesting that the < /b> loss of < /b> activity at low concentration maybe attributed to subunit dissociation. In contrast, both the < /b> WT and < /b> WT* enzymes show no concentrationdependence of < /b> specific activity, ... serve to position the < /b> functional K12 residue. The < /b> network of < /b> key interactions spans the< /b> interacting subunits. The < /b> Y74W* mutation can perturb orientations of< /b> the < /b> active site residues, due to steric...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt
... activity is a subject thatmerits our attention. The < /b> site of < /b> action of < /b> quinoloneantibiotics has been determined to be on < /b> the < /b> gyrA sub-unit of < /b> the < /b> enzyme, due to the < /b> ability of < /b> the < /b> mutation of < /b> ... whereas the< /b> N-terminal segment has the < /b> ability to bind to DNAaccording to its acetylation and < /b> methylation status[29]. The < /b> possibility that HN and < /b> H4-(86–100) bind toDNA gyrase to inhibit its activity ... lgÆmL)1)makes this structure attractive for further consi-deration.Potentiation of < /b> the < /b> antimicrobial activity of < /b> HN and < /b> related compounds by ATP In ammation caused by infection or wounds triggers the < /b> stimulation...
- 12
- 756
- 0
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt
... forma-tion, with the < /b> level of < /b> foci formation obtained for the < /b> empty vectorcontrol point set to 100%. In the < /b> SRblow point, one-fifth the < /b> usualamount of < /b> SRb expression construct was introduced. The < /b> graphshows ... likely contribution of < /b> other regions of < /b> the < /b> Mxi1-SRa protein. In the < /b> future, it would be important to uncover the< /b> full spectrum of < /b> differentially interacting proteins, aswell as the < /b> spectrum of < /b> downstream ... wasgenerated by introducing the < /b> WR cDNA containing the < /b> full5¢-UTR in pcDNA3.1. The < /b> coding region of < /b> Mxi1-SRa and< /b> Mxi1-SRb were subcloned by PCR in a vector containingan amino terminal flag tag. The...
- 11
- 586
- 0
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc
... resistant to conventional toxins [33–35], showsgreat promise. One of < /b> the < /b> major drawbacks of < /b> usingthese toxins is that they must be able to preserve the< /b> main characteristics of < /b> the < /b> toxin during the < /b> ... numbers are indicated on < /b> the < /b> right. The < /b> ‘+’ symbol represents the < /b> aminoacid residues of < /b> the < /b> heparin-binding site (HBS) of < /b> VVA2 (166–194). (B) Inhibitory effects < /b> of < /b> VVA1 on < /b> the < /b> binding of < /b> VVA2 to ... direct interaction between VVA1 and < /b> VVA2, and < /b> that at a VVA2 ⁄ VVA1 molar ratio of < /b> 2, VVA1 isable to inhibit the < /b> oligomerization of < /b> VVA2. Extendingthese results, we hypothesized that the < /b> inhibition...
- 12
- 585
- 0
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx
... results indicate that the < /b> maximal rate of < /b> the < /b> mutantEF-Ts in protein synthesis in vivo is 70%ofthatofthewild-type EF-Ts. The < /b> studies of < /b> the < /b> effect of < /b> the < /b> EF-Ts mutation understarvation conditions ... D420value of < /b> the < /b> culture at the < /b> interception point between the < /b> exponential and < /b> the< /b> Ôstarvation phaseÕ of < /b> growth, is 78% of < /b> the < /b> point of < /b> growthinhibition of < /b> UY211 (D420¼ 0.60). The < /b> point of < /b> growthinhibition ... family of < /b> antibiotics that inhibitsprotein synthesis by binding EF-Tu–GTP and < /b> preventing the < /b> release of < /b> EF-Tu–GDP from the < /b> ribosome [24]. Theseantibiotics bind at the < /b> interface between domain 1...
- 12
- 502
- 0
Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx
... activity, thereby providingfurther strength to the < /b> argument that additional mecha-nisms, other than the < /b> inhibition of < /b> NF-jB, account for the< /b> inhibition by dexamethasone. However, the < /b> basis of < /b> ... ligand-binding studies (Fig. 6). It is pos-sible that at these high concentrations RU486 is acting in aGR-independent manner. Notwithstanding the < /b> inhibition athigh doses, it is clear that at ... contrast, the < /b> inhibition of < /b> NF-jB-dependent tran-scription by high c oncentrations of < /b> RU486 correlated v eryclosely, in terms of < /b> both apparent efficacy a nd potency, with the < /b> inhibition of < /b> COX/PGES...
- 11
- 527
- 0
Từ khóa: effects of environmental pollution on the respiratory and integumentary systemseffects of air pollution on the environment and humanseffects of air pollution on the environment and human healthbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam