Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... The Authors Journal compilation ê 2009 FEBS Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary ... Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* ... fromGiardia lamblia, which contains a Trp residue at the structurally equiva-lent position, establishes the need for complementary mutations and maintenance of weak interactions in order to accommodate...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... proteins contained in aggregates within theotolith matrix and identified a protein contained in the HMW protein glycosaminoglycan aggregate thatalso contains the otolith structural protein otolin-1.This ... digestion of genomic DNA con-tamination in the total RNA was confirmed by lack of amplification of a b-actin mRNA fragment by PCR using a pair of primers (5Â -ATCACCATCGGCAACGAGAG-3Âand 5Â-TGGAGTTGTAGGTGGTCTCGTG-3Â) ... macromolecule-64(OMM-64), that is contained in a HMW aggregate in the otolith matrix. During characterization of this protein, we revealed that the aggregate also contains theinner ear-specific collagen otolin-1 [9].ResultsCloning...
- 12
- 568
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... nm, and at the same time, distinct absorption bands of oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. ... vanishedafter 30 min, and instead, an absorption peakappeared at 637 nm, suggesting the formation of CO–verdoheme. The 637 nm band disappeared gradu-ally and was replaced by a new broad band ... Fig. 5A, addition of ascorbate to the solution of heme GmHO-1 initiates the reaction, as revealed by gradual diminution of the Soret band. After several minutes, a broad bandappears at around...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf
... Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates Ramasubramanian ... suite: programs for protein crystallo-graphy.Acta Crystallogr D Biol Crystallogr 50, 760–763.28 Navaza J (1994) Amore – an automated package formolecular replacement. Acta Crystallogr A 50, 157–163.29 ... parameters (B-factors) and, whereappropriate, the ligand occupancies.Superposition of subunit A on B and C (468 Caatoms) in complex II and III of LlPDH gives an rmsd of 1.6 A ˚in each case,...
- 12
- 452
- 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt
... abzymes; nitrosoalcanes;microperoxidase 8; S-oxidation. Catalytic antibodies with a metalloporphyrin cofactor, orÔhemoabzymesÕ, are not as efficient a category of catalysts astheir natural hemoprotein ... set of six monoclonalantibodies was thus obtained: the best peroxidase activity –that found with the complex of MP8 and one of thoseantibodies, 3A3 – was characterized by a kcat/Kmvalue of 2 ... counterparts. The hemoabzymes,which display a peroxidase activity, are characterized bykcat/Kmvalues that are three to four orders of magnitudelower than those for natural peroxidases [1]....
- 7
- 447
- 0
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation Jo´hanna Arno´rsdo´ttir1, Magnu´s M. Kristja´nsson2and Ralf Ficner11 Abteilung ... glycosylase from Atlantic cod (Gadus morhua) reveals cold- adaptation features. Acta Crystallogr Sect D 59, 1357–1365.10 Aghajari N, Van Petegem F, Villeret V, Chessa JP,Gerday C, Haser R & Van ... C,Feller G & Van Beeumen J (2003) The structure of a cold- adapted family 8 xylanase at 1.3 A ˚resolution. Structural aspects of cold adaptation J. Arno´rsdo´ttir et al.842 FEBS Journal 272...
- 14
- 597
- 0
![Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc](https://media.store123doc.com/images/document/14/br/vp/small_vpv1392870032.jpg)
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... alkyla-tion leading to a depletion of mtDNA in intact cells(Fig. 1). Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... should also alkylate mtDNA within mitochondria and cells.MitoDC-81 does not alkylate mtDNA in isolated mitochondria Having ascertained that mitoDC-81 was sequestered byisolated mitochondria and ... plasma membrane potential and thenbe further accumulated within the mitochondria due to themitochondrial membrane potential [11]. From the knownplasma and mitochondrial membrane potentials and...
- 10
- 638
- 0
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx
... Computational LinguisticsHuman Evaluation of a German Surface Realisation RankerAoife CahillInstitut făur Maschinelle Sprachverarbeitung (IMS)University of Stuttgart70174 Stuttgart, Germanyaoife.cahill@ims.uni-stuttgart.deMartin ... evaluation metrics cannotbe avoided, but ideally, a metric for the evaluation of realisation rankers would rank alternative real-isations in the same way as native speakers of thelanguage for ... Germanyaoife.cahill@ims.uni-stuttgart.deMartin ForstPalo Alto Research Center3333 Coyote Hill RoadPalo Alto, CA 94304, USAmforst@parc.comAbstractIn this paper we present a human-based evaluation of...
- 9
- 479
- 0
Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot
... the structure of N-terminal lipids of native S. aureus lipoproteins. Here,we provide solid structural evidence for N-acylatedtriacyl forms of SitC and four other lipoproteins inS. aureus RN4220 ... lipoprotein from S. aureus istriacylated [15]; however, we could not show structural evidence of N-acylation of the lipoprotein. In addition,some triacylated lipoproteins of Mollicutes, which ... other strains of S. aureus and one strain of S. epidermidis, and four other lipoproteins in S. aureus were shown to be N-acylated. These results stronglysuggest that lipoproteins in S. aureus are...
- 13
- 407
- 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... -FnBPB-1FnBPB-2/3FnBPB-4FnBPB-5FnBPB-6FnBPB-7FnBPB-8FnBPB-9FnBPB-10FnBPB-11GSTFnBRBFnBPB-1FnBPB-2/3FnBPB-4FnBPB-5FnBPB-6FnBPB-7FnBPB-8FnBPB-9FnBPB-10FnBPB-11GSTFnBRAFnBPA-1FnBPA-2FnBPA-3FnBPA-4FnBPA-5FnBPA-6FnBPA-7FnBPA-8FnBPA-9FnBPA-10FnBPA-11GSTFnBRA A< /b> 490 ... -FnBPB-1FnBPB-2/3FnBPB-4FnBPB-5FnBPB-6FnBPB-7FnBPB-8FnBPB-9FnBPB-10FnBPB-11GSTFnBRBFnBPB-1FnBPB-2/3FnBPB-4FnBPB-5FnBPB-6FnBPB-7FnBPB-8FnBPB-9FnBPB-10FnBPB-11GSTFnBRAFnBPA-1FnBPA-2FnBPA-3FnBPA-4FnBPA-5FnBPA-6FnBPA-7FnBPA-8FnBPA-9FnBPA-10FnBPA-11GSTFnBRA A< /b> 490 nmABCD3.02.52.01.51.00.50.0 A< /b> 490 ... Functional < /b> analysis < /b> of < /b> a < /b> murine < /b> monoclonal < /b> antibody< /b> against < /b> the < /b> repetitive < /b> region < /b> of < /b> the < /b> fibronectin-binding < /b> adhesins < /b> fibronectin-binding < /b> protein < /b> A < /b> and < /b> fibronectin-binding < /b> protein < /b> B from Staphylococcus...
- 16
- 560
- 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx
... kDa), and carbonic anhydrase (29 kDa)] is shownas the standard curve. The molecular mass of native Bt -Lon (s)wasestimated from the standard curve based on the elution volume of native Bt -Lon and ... b-D-thio-galactoside (Fig. 3, lanes 2 and 3). SDS/PAGE analysisindicated that the recombinant protein was a single band of 90 kDa after purification by affinity and gel filtrationchromatography (Fig. ... 811–819.28. Lanzetta, P .A. , Alvarez, L.J., Reinach, P.S. & Candia, O .A. (1979)An improved assay for nanomole amounts of inorganic phos-phate. Anal. Biochem. 100, 95–97.29. Farahbakhsh, Z.T., Huang,...
- 11
- 505
- 0
Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx
... FEBS Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast Coq1*Mei Zhang, Jun Luo, Yuki Ogiyama, Ryoichi Saiki and Makoto KawamukaiDepartment ... Okada K, Kainou T, Tanaka K, Nakagawa T, MatsudaH & Kawamukai M (1998) Molecular cloning and mutational analysis of the ddsA gene encoding decapre-nyl diphosphate synthase from Gluconobacter ... (5Â-to3Â)COQ1-BamHICCGGATCCCATGTTTCAAAGGTCTGGCCOQ1-SmaI GCCCCCGGGTTACTTTCTTCTTGTTAGTATACCOQ1-BamHI-TP45CCGGATCCATGTTTCAAAGGTCTGGCCOQ1-EcoRI CGAATTCTTACTTTCTTCTTGTCOQ1 -a CAGTGAATTCGAGCTCGGTACCCCOQ1-b ATACATACTGAATCATCATCTCCTTCGAG dps1- a...
- 16
- 315
- 0
Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx
... causative agent of the various pig and monkey infections on the island of Bali and the other islands of Indonesia [15]. These findings raises the question whether the bacterial clone discovered in ... describedoutbreak among the pig and monkey population on the island of Bali, Indonesia. These findings indicate that the mucoid growing S. equi subsp. zooepidemicus clone wasstill present in the pig and ... during the pig and monkey disease in 1994 is, at least till the year 1998, still present in the pig and monkey population on the various islands in Indonesia. The isolation of the strains generally...
- 3
- 314
- 0
báo cáo khoa học: " Granulomatous infiltration of a parathyroid adenoma presenting as primary hyperparathyroidism in a woman: a case report" ppt
... 21:438-441.doi:10.1186/1752-1947-4-400Cite this article as: Anaforoğlu et al.: Granulomatous infiltration of a parathyroid adenoma presenting as primary hyperpara thyroidism in a woman: a case report. Journal of Medical Case Reports ... Medical Case Reports 2010, 4:400http://www.jmedicalcasereports.com/content/4/1/400Page 4 of 4 CASE REPO R T Open Access Granulomatous infiltration of a parathyroid adenoma presenting as primary ... cause of hypercalcemia among out-patients, whereas malignancy is the leading underlyingdisorder in hospital cases . Solitary parathyroid adenoma followed by parathyroid hyperplasia and carcinoma...
- 4
- 157
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI