0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Development and Evaluation of a New Apparatus for Continuous Perfusion of Isolated Perfused Pig Heart" ppt

Báo cáo khoa học:

Báo cáo khoa học: "Development and Evaluation of a New Apparatus for Continuous Perfusion of Isolated Perfused Pig Heart" ppt

... heart fibrillated and stopped*: pacemaker on at the frequency of 110 from 50 minutes of perfusion Development and Evaluation of a New Apparatus for Continuous Perfusion of Isolated Perfused Pig ... heart fibrillated and stopped*: pacemaker on at the frequency of 110 from 50 minutes of perfusion Development and Evaluation of a New Apparatus for Continuous Perfusion of Isolated Perfused Pig ... Scientific, Avantec Inc., A: An’s CannulaB: Casali’s cannulaFig. 1. The new coronary cannula maded for this study (A: An’s Cannula) and the coronary cannula used in the work ofCasali et al(B: Casali’s...
  • 14
  • 431
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf

... possible fea- Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals Ezra Black John Lafferty Salim Roukos <black I j laff ] roukos>*watson, ... of application domain. • Development of a manually-bracketed corpus (tree- bank) of the domain. • Creation of a grammar with a large coverage of a blind test set of treebanked text. Statistical ... range of sentence types and the availability of large corpora of computer manuals. We amassed a corpus of 40 million words, consisting of several hundred computer manuals. Our approach in attacking...
  • 8
  • 562
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated ... Social Sciences and Humanities Research Council of Canada. [1] Reduplication is a word formation process involving the repetition of a word or a part of a word. As an example, in Warlpiri...
  • 8
  • 522
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Contents and evaluation of the first Slovenian-German online dictionary" doc

... Slovenian-German and German-Slovenian onlinedictionary and contains evaluation fig-ures for its Slovenian part. Evaluationsare based on coverage of a Sloveniannewspaper corpus as well as on userqueries.1 ... singular form of verbs;•common conversational phrases and multi-word expressions as well as some contextualexamples of words and grammatical forms.Grammar information for both languages and information ... lemma(s)wordcorpusformfrequencyaids:Saids:Saids:Sali:avto:Savto:S :*avt:Savto:S :*avt:Savto:S ;*avt:Saidsaidsaaidsomauiavtoavtaavtomavtu527466391198,3997,4502,5761,9481,519Lemmatized...
  • 4
  • 321
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf

... shows a four-category data configu- 247 Development and Use of a Gold-Standard Data Set for Subjectivity Classifications Janyce M. Wiebet and Rebecca F. Bruce:[: and Thomas P. O'Harat tDepartment ... reliably annotated gold standard to support experimenting with such applications. This research is also a case study of ana- lyzing and improving manual tagging that is applicable to any tagging ... ing manual results in as much as a 16 point im- provement in pairwise Kappa values, and raises the average agreement among the judges to a Kappa value of over 0.87 for the sentences that can...
  • 8
  • 354
  • 0
báo cáo hóa học:

báo cáo hóa học: " Development and evaluation of a computer-based medical work assessment programme" pdf

... Main and second activitiesStatus CA1 CA MA1, SA MA, SA1 MA, SA MA, SA MA, SAEvent +CA2 +SA +MA2 + SA2 +CA -SA -MAResult CA1 stop CA → MA MA1 stop SA1 stop MA stop SA stop MA stopCA2 start SA ... SA start MA2 start SA2 start SA stop MA → CA SA stopCA start SA → CACA startCA = Central Activity (no second activity).MA = Main Activity.SA = Second Activity.Journal of Occupational Medicine ... recording software translates the job task catego-ries from the Visual Basic data bank and generates a cate-gory tab for every element of this group. Single activitiesare added in a list accordingly...
  • 5
  • 381
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses" pdf

... consensus primers (D1:5' TCAATATGCTAAAACGCGCGAGAAACCG 3' and D2:5' TTGCACCAACAGTCAATGTCTTCAGGTTC 3').Dengue Nested PCRThe nested PCR assay was performed according to the pro-tocol ... forward primer (D1), and four serotypespecific reverse primers (Ts1: 5' CGTCTCAGTGATCCG-GGGG 3', Ts2: 5'CGCCACAAGGGCCATGAACAG 3', Ts3:5' TAACATCATCATGAGACAGAGC 3' ... 121:9-12.10. Parida MM, Upadhyay C, Saxena P, Dash PK, Jana AM, Seth P: Evalu-tion of a Dipstick ELISA and a rapid Immunochromato-graphic test for diagnosis of dengue virus infection. ActaVirologica 2001,...
  • 5
  • 482
  • 0
báo cáo hóa học:

báo cáo hóa học:" Development and evaluation of a clinical algorithm to monitor patients on antiretrovirals in resource-limited settings using adherence, clinical and CD4 cell count criteria" ppt

... not for citation purposes)Table 1: Univariate analysis of variables associated with viral failure in 496 Ugandans on ART at the Infectious Diseases Institute, Kampala, UgandaVariable Total ... Mandalia, Jessica Oyugi, Rose Naluggya, Ali Taylor, Petra Schaefer, David Thomas, Keith McAdam and all the staff of the Adult Infectious Disease Clinic and the Academic Alliance.The study was ... Burkina Faso, West Africa. AIDS 2005, 19:1273-77.9. Waters L, Kambugu A, Tibenderana H, Meya D, John L, Mandalia S,Nabankema M, Namugga I, Quinn TC, Gazzard B, Reynolds SJ, NelsonM: Evaluation of...
  • 10
  • 533
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... where a multiplicity of sentiments for a variety of topics and corresponding targets are potentially involved (Riloff and Wiebe., 2003; Sarmento et al., 2009). Alternative approaches to automatic ... Conference and Empiri-cal Methods in Natural Language Processing, Canada. 568Proceedings of the 49th Annual Meeting of the Association for Computational Linguistics:shortpapers, pages 564–568,Portland, ... 564–568,Portland, Oregon, June 19-24, 2011.c2011 Association for Computational LinguisticsLiars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates Paula Carvalho...
  • 5
  • 499
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM