Báo cáo khoa học:When Can You Tile a Box With Translates of Two Given Rectangular Brick pot
Báo cáo khoa học:When Can You Tile a Box With Translates of Two Given Rectangular Brick pot
... 2When Can You Tile a Box With Translates of Two Given Rectangular Bricks?Richard J. Bower and T. S. Michael∗Mathematics Department, United States Naval AcademyAnnapolis, MD 21402tsm@usna.eduSubmitted: ... instance, Figure 1shows two tilings of a box R with translates of two rectangular bricks B1and B2. In (a) the box R is partitioned by a plane into two sub-boxes R1and R2, and the sub -box ... rectangular bricks B1and B2?WeprovethatR can be tiled by translates of B1and B2if and only if R can be partitioned by a hyperplane into two sub-boxes R1and R2such that Ri can be tiled...
- 9
- 329
- 0
Báo cáo khoa học: Nanoparticles can induce changes in the intracellular metabolism of lipids without compromising cellular viability docx
... (Nepean, Canada); Alamar bluereagent from Biosource (Montreal, Canada); paraformal-dehyde (PFA) from BDH Laboratories (Poole, UK);glia-specific rabbit GFAP antibody (Z0334) from DokoCytomation ... tissues[25,26]. Hypoxia and hypoxia-related signaling havebeen associated with major pathologies, such as car-diovascular disease, stroke and cancer [27]. The sig-naling for hypoxia was of interest ... Shvedova AA, Castranova V, Kisin ER, Schwegler-Berry D, Murray AR, Gandelsman VZ, Maynard A &Baron P (2003) Exposure to carbon nanotube material:assessment of nanotube cytotoxicity using human...
- 14
- 540
- 0
Báo cáo khoa học: "When Conset meets Synset: A Preliminary Survey of an Ontological Lexical Resource based on Chinese Characters" doc
... CharactersShu-Kai HsiehInstitute of LinguisticsAcademia SinicaTaipei, Taiwanshukai@gate.sinica.edu.twChu-Ren HuangInstitute of LinguisticsAcademia SinicaTaipei, Taiwanchuren@gate.sinica.edu.twAbstractThis ... The character ontology: a snapshot4.2 Characters in a Small WorldIn addition, an experiment concerning the char-acter network that was based on the meaning as-pects of characters, was performed ... system can achieve fairlyhigh level of performance. Meaning relevant NLPTasks such as Word Sense Disambiguation are alsoin preparation.389Figure 2: The Schematic Representation of character-triggered...
- 6
- 329
- 0
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf
... where a multiplicity of sentiments for a variety of topics and corresponding targets are potentially involved (Riloff and Wiebe., 2003; Sarmento et al., 2009). Alternative approaches to automatic ... specific target than negative opinions. We believe that the validation of this hypothesis requires a thorough study, based on a larger amount of data spanning more electoral debates. Based on ... Conference and Empiri-cal Methods in Natural Language Processing, Canada. 568Proceedings of the 49th Annual Meeting of the Association for Computational Linguistics:shortpapers, pages 564–568,Portland,...
- 5
- 499
- 0
Báo cáo khoa học: Peroxiredoxins as cellular guardians in Sulfolobus solfataricus – characterization of Bcp1, Bcp3 and Bcp4 pot
... minand 72 °C for 1 min, for 35 cycles using HF Taq DNApolymerase (Roche). For bcp4, the forward primer5¢-CAAAATCTTTCATATGGTAGAAATAGG-3¢ and thereverse primer 5¢-GCCTAGCCATAACATCTCGAGAGATA-3¢ ... for 1 min and 72 °C for 1 min, for 35 cyclesusing HF Taq DNA polymerase (Roche Applied Science,Monza, Italy). For bcp3, the forward primer 5¢-AAATTCATATGAACGTAGGAGAAGAAGCACCAG-3¢ and thereverse ... molecular mass of 16 976.42 Da and a theoretical pI of 8.84. Comparison of the sequences of S. solfataricus Bcps revealed an approximate 35%identity for Bcp1, Bcp3 and Bcp4. A BlastP search against...
- 11
- 439
- 0
Báo cáo khoa học: "Much ado about nothing: A social network model of Russian paradigmatic gaps" ppt
... persistence and spread of Russian gaps via a multi-agent model with Bayesian learning. We ran three simulations: no grammar learning, learning with arbitrary analogical pressure, and morphophonologically ... development of Russian gaps. 2 The historical and distributional facts of Russian verbal gaps 2.1 Traditional descriptions Grammars and dictionaries of Russian frequently cite paradigmatic gaps ... heavily favor a single form, for example, pobežu. Traditional explanations for the gaps, such as homophony avoidance (Švedova 1982) are also unsatisfactory since they can, at best, explain...
- 8
- 409
- 0
Báo cáo khoa học: Transgenic Cdx2 induces endogenous Cdx1 in intestinal metaplasia of Cdx2-transgenic mouse stomach pot
... Satoh K, Mutoh H, Eda A, Yanaka I, Osawa H,Honda S, Kawata H, Kihira K & Sugano K (2002)Aberrant expression of CDX2 in the gastric mucosa with and without intestinal metaplasia: effect of ... (CCCGCGGCTATAAAAGGCCGGGGTGGGG) containing the TATAAA sequence in the Cdx1 promoter was incubated with nuclearextracts from AGS cells and separated on a 5% polyacrylamide gel (lane 2). Specificity was ... of eradica-tion of Helicobacter pylori. Helicobacter 7, 192–198.5 Mutoh H, Hakamata Y, Sato K, Eda A, Yanaka I,Honda S, Osawa H, Kaneko Y & Sugano K (2002)Conversion of gastric mucosa to...
- 11
- 252
- 0
Báo cáo khoa học: Apolipoprotein E-derived antimicrobial peptide analogues with altered membrane affinity and increased potency and breadth of activity pdf
... PeptProtein Res 48, 357–363.39 Masuda M, Nakashima H, Ueda T, Naba H, Ikoma R,Otaka A, Terakawa Y, Tamamura H, Ibuka T, Mura-kami T et al. (1992) A novel anti-HIV synthetic peptide,T-22 ([Tyr5,12,Lys7]-polyphemusin ... 442–450.13 Clay MA, Anantharamaiah GM, Mistry MJ,Balasubramaniam A & Harmony JA (1995) Locali-zation of a domain in apolipoprotein E with bothcytostatic and cytotoxic activity. Biochemistry ... concentrations of apoE-AMPs, showingapoEdp has optimum activity. Typical data are shown; bars indicatestandard errors. (B) Growth of P. aeruginosa, in the presence of various concentrations of ApoE-AMPs,...
- 15
- 317
- 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
... thehead disclosing a 1.4 × 1.3 cm pituitary adenoma,cervical ultrasound and Tc99 m Sestamibi-scans bothdisclosing hyperplasia of the parathyroid glands, abdom-inal MRI scan and endoscopic ultrasound ... Rodríguez-Espinosa J, Blanco-Vaca F, Matías-Guiu X, deLeiva A, Mauricio D: Genetic, clinical, and biochemical analysis of unrelated Spanish families with multiple endocrine neoplasia type I.Endocr Pract ... liver diseases are the most frequent diagnoses inpatients with increased CA-125, other i ntra-abdominalnon-malignant non-hepatic diseases can also cause eleva-tion of the CA-125 [34], as in the...
- 7
- 412
- 0
báo cáo khoa học: "Yolk sac tumor in a patient with transverse testicular ectopia" pot
... gonads are at increased risk of malignant transformation [4]. We report a case of yolk sactumor in the ectopic testis of a patient with TTE.Case Presentation A 24-year-old man, who had fathered ... revealed testicular yolk sac tumor of the ectopictestis. An enlarging left inguinal-mass appeared 2 months ago and he was referred to our hospital. Laboratory datashowed an elevation of AFP ... TTE and its associated anomalies[8].TTE has been classified into three types on the basis of associated anomalies: (1) associated with inguinalhernia alone (40% to 50%); (2) associated with...
- 4
- 380
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ