ICENI: Optimisation of Component Applications within a Grid Environment pot
ICENI: Optimisation of Component Applications within a Grid Environment pot
... CommunityPublicUsersDomainAdministrativeDataResourceResourceComputationalSoftwarePrivate PolicyManagerManagerComputational CommunityPublicMapperApplicationFrameworkActivationBrowserResourceResourceManagerIdentitye.g ... ...
- 21
- 117
- 0
SOLVING THE PROBLEM OF CHILDHOOD OBESITY WITHIN A GENERATION potx
... nutritional standards based on the Dietary Guidelines and appeal to children. Food manufacturers and marketers have a critical role to play in meeting new stan-dards, and have already shown an ability ... recently-enacted Patient Protection and A ordable Care Act, as amended by the Health Care and Education A ordability Reconciliation Act (collectively referred to as the A ordable Care Act”) provides ... similar law prior to enactment of the A ordable Care Act, and early research indicates it may have favorably a ected eating habits, although rm conclusions cannot yet be drawn.122 A recent...
- 124
- 1,038
- 0
Báo cáo hóa học: " Predicting the subcellular localization of viral proteins within a mammalian host cell" doc
... can accurately predict theintracellular localization of viral proteins in human cells.Our viral subcellular localization predictions are availableas additional files.ResultsEukaryotic targeting ... UL33 and US27in endocytic compartments and viral membranes. Traffic2002, 3:218-232.69. Ogawa-Goto K, Irie S, Omori A, Miura Y, Katano H, Hasegawa H,Kurata T, Sata T, Arao Y: An endoplasmic ... prediction dataset is available as supplementarymaterial, please see Additional file 2). The predictionaccuracy of PSLT on this dataset is estimated to be 60%according to the literature. Almost all...
- 8
- 302
- 0
Báo cáo hóa học: " Characterization of diverse natural variants of CYP102A1 found within a species of Bacillus megaterium" potx
... primers and B. megaterium chro-mosomal DNA template. First, PCR was carried out in a 50 μl reaction mixture containing template plasmid, for-ward primer BamHI-F (5’- AGCGGATCCATGACAAT-TAAAGAAATGCCTC-3’) ... 52°C, and 90 s of extension at 72°C. Next, PCR wascarried out in a similar way by use of forward primerSacI-F (5’ -ATACAAACTACGAGCTCGAT-3’ )andreverse primer XhoI-R (5’ -ATCCTCGAGTTACC-CAGCCCACACGTC-3’). ... 1).Biochemical characterization of the natural variantsThe biochemical properties of the variants were exam-ined. All CYP10 2A1 variants could bind to satu ratedfatty acids in the range of 12-16 carbons...
- 12
- 354
- 0
A Review of Approaches to Mobility Telemonitoring of the Elderly in Their Living Environment potx
... sys-tem must be accurate, reliable, and have continuous ac-cess to an alarm center. An inaccurate system which raisesfalse alarms wastes valuable healthcare resources; can leadto a lack of confidence ... Wearable data forwarding systems, the lightestwearable option, are suited to the frail and housebound asthey analyze the data in real-time and can raise immediatealerts. Data-logging wearables ... real-time feedback to a user and do not require large amounts of data storage, as the raw data are typically summarized inreal-time before storage or transmission. The use of sum-marized data also reduces...
- 17
- 603
- 1
The Treatment of Uncertainty in EPA’s Analysis of Air Pollution Rules: A Status Report pot
... of Air Quality Planning and Standards. www.epa.gov/ttn/ecas/regdata/RIAs/finalpbria.pdf. ———. 200 9a. Proposed NO2 NAAQS Regulatory Impact Analysis (RIA). Research Triangle Park, NC: Office ... Regulatory Impact Analysis, March 2008. National Ambient Air Quality Standards for Ground-level Ozone, Chapter 6. Research Triangle Park, NC: Office of Air Quality Planning and Standards. www.epa.gov/ttn/ecas/regdata/RIAs/6-ozoneriachapter6.pdf ... Treatment of Uncertainty in EPA’s Analysis of Air Pollution Rules: A Status Report Arthur G. Fraas Abstract An understanding of the uncertainty in benefit and cost estimates is a critical part...
- 24
- 427
- 0
Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot
... is a language-independent algo-rithm.English Phrase: the advisory committeeArabic Phrase: Alljnp AlAst$ArypTask: stem AlAst$ArypChoices ScoreAlAst$Aryp 0.2AlAst$Aryp 0.7AlAst$Aryp ... 1999).Usually, entire documents are translated by humans,and the sentence pairs are subsequently aligned byautomatic means. A small parallel corpus can beavailable when native speakers and translators ... text.1.1 Arabic detailsIn this paper, Arabic was the target language but theapproach is applicable to any language that needsaffix removal. In Arabic, unlike English, both pre-fixes and suffixes...
- 8
- 424
- 0
Within A Budding Grove potx
... at all disapprove of your idea of taking up writing,’ my father had reported. And as he had a certain amount of inuence himself, he imagined that there was nothing that could not be ‘arranged,’ ... not in a position to make compari-sons, and would have been greatly surprised to learn that he was not at all a rude man by nature. Complete impas-sivity was what he strove to attain, and even ... he had been Minister Plenipotentiary before the War, and was actually an Ambassador on the Sixteenth of May; in spite of which, and to the general astonishment, he had since been several times...
- 783
- 500
- 0
Guy Fawkes or A Complete History Of The Gunpowder Treason, A.D. 1605 pot
... saw a man standing in a corner of the cellar, who stated that he was Percy'sservant, and that he was left by his master in charge of the house and cellar. This individual was Guy Fawkes,who ... a treatise licensed by Garnet and Blackwall. Certain instances are given in the workas illustrations of the doctrine. The following is one of these cases. A man arrives at a certain place, and ... and was the means of suspending theoperations of the conspirators for a season. As soon as James's accession was known, the king of Spainendeavoured to enter into a negociation for peace,...
- 74
- 422
- 0
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
... ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTCCTCGACCAAAAAGATC; rcpA:forward,GCGATAGAATTCATGAGCGTAGAAACGGAAGAC and reverse, CGAAGCTTGTCGACTCAGTGATGGTGGTGATGGTGCTCCGACGGCAATGTCG; cphB:forward,GCGATAGAATTCATG ... cphB:forward,GCGATAGAATTCATG ACGAATTGCGATCGCGA and reverse, ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTTTGACCTCCTGCAATGT; cphBlong:forward,GCGATAGAATTCATGTTGCAGTTAATTTATAACAATT; the reverseprimer was identical to that used ... principally allowing covalent chromophore binding.Forward primer: 5¢-CACTCGGTACTCCGCAGCGTTTCGCCGTGTCACATTGAATATTTGCACAATATGG-3¢; reverse primer: 5¢-CCATATTGTGCAAATATTCAATGTGACACGGCGAAACGCTGCGGAGTACCGAGTG-3¢....
- 10
- 499
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI