Báo cáo hóa học: " Pb(core)/ZnO(shell) nanowires obtained by microwave-assisted method" docx
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... gcgcggatccttaacttgtatataaataSED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaataSEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaataSEG AF064773 tgtgcatatgcaacccgatcctaaatta ... tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaagaSEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacataSElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttataSElN AF285760 aatgctcatatggacaaaaaagatttaaag ... aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaaSElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaacSeo et al. Journal of Translational Medicine 2010, 8:2http://www.translational-medicine.com/content/8/1/2Page...
- 9
- 568
- 0
báo cáo hóa học: "Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" pptx
... purposes)Health and Quality of Life OutcomesOpen AccessResearchUse of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in GeorgiaRoumiana ... and healthliteracy may have affected the accuracy of these data. Our study was cross-sectional in nature and does not allow forproper evaluation of treatment efficacy. Also, data on drug and ... fatigue, chronic fatigue syndrome, and fibromyalgia. Disability and health-care use.Med Care 1996, 34:924-930.2. Jason LA, Richman JA, Rademaker AW, Jordan KM, Plioplys AV, Tay-lor R, et al.:...
- 11
- 512
- 0
báo cáo hóa học: " Anti-inflammatory therapy by ibudilast, a phosphodiesterase inhibitor, in demyelination of twitcher, a genetic demyelination model" docx
... of NeuroinflammationOpen AccessResearch Anti-inflammatory therapy by ibudilast, a phosphodiesterase inhibitor, in demyelination of twitcher, a genetic demyelination modelKuriko Kagitani-Shimono1,2,3, ... 5'-TTTCTCCTGGTATGAGATAGC-3', TNFR1 forwardprimer: 5'-CTAAACAGCAGAACCGAGTGT-3', TNFR1reverse primer: 5'-AGATACGTAGAGTGTCCTTGG-3',TNFR2 forward primer: 5'-ATAAAGCCACAC-CCACAACCT-3', ... School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan, 2Department of Molecular Behavioral Biology, Osaka Bioscience Institute, 6-2-4, Furuedai, Suita, Osaka, 565-0874, Japan and 3Department...
- 12
- 411
- 0
báo cáo hóa học:" Thoracic myelopathy caused by ossification of ligamentum flavum of which fluorosis as an etiology factor" ppt
... activation and pro-liferation of osteoblast-like cells with enhanced expres-sion of messenger ribonucleic acid and proteins of c-fosand c-jun.Clinical feature of thoracic ossification of ligamentum ... and 2003, 23 of which (16 male and 7 female) were caused by fluorosis. The 23patients ranged in age from 42 to 72 years (mean 54.8years). 6 cases had acute onset of clinical symptom, 4 of which ... 1 of 10(page number not for citation purposes)Journal of Orthopaedic Surgery and ResearchOpen AccessResearch article Thoracic myelopathy caused by ossification of ligamentum flavum of which...
- 10
- 366
- 0
Báo cáo hóa học: " Cellular apoptosis induced by replication of hepatitis B virus: possible link between viral genotype and clinical outcome" docx
... AccessShort report Cellular < /b> apoptosis < /b> induced < /b> by < /b> replication < /b> of < /b> hepatitis < /b> B virus: possible link between viral genotype and clinical outcomeYi Wei Lu, Tuan Lin Tan, Jianhua Zhang and Wei Ning Chen*Address: ... wereobserved under phase contrast microscope, stained by < /b> apoptosis < /b> marker and analyzed by < /b> flowcytometre. HBSP expression was detected by < /b> western blot assay. BH3 sequences were aligned and analyzed ... the reported clinical outcome of< /b> infection by < /b> different HBV genotypes.Introduction Hepatitis < /b> B virus (HBV), with eight genotypes (A-H) basedon sequence divergence, is one of < /b> the global health...
- 5
- 291
- 0
báo cáo hóa học:" Optical Nerve Detection by Diffuse Reflectance Spectroscopy for Feedback Controlled Oral and Maxillofacial Laser Surgery" ppt
... 9:20http://www.translational-medicine.com/content/9/1/20Page 5 of 9RESEARCH Open Access Optical Nerve Detection by Diffuse Reflectance Spectroscopy for Feedback Controlled Oral and Maxillofacial Laser SurgeryFlorian Stelzle1*, Azhar Zam4, ... investigate diffuse reflectance spectroscopy for tissue differentiation as the base of a feedback control system to enhance nerve preservation in oral and maxillofacial laser surgery.Methods: Diffuse reflectance ... 1).Discussion For feedback controlled laser surgery, tissue differentia-tion is a crucial step. Especially in oral and maxillofacial Figure 2 Non-standardized diffuse reflectance spectra for different...
- 9
- 454
- 0
báo cáo hóa học:" An inexpensive and rapid diagnostic method of Koi Herpesvirus (KHV) infection by loop-mediated isothermal amplification" docx
... rapid diagnostic method of Koi Herpesvirus (KHV) infection by loop-mediated isothermal amplificationHatem Soliman and Mansour El-Matbouli*Address: Institute of Zoology, Fish Biology and Fish ... author AbstractBackground: Koi Herpesvirus (KHV) affects both juvenile and adult common carp and koi, and isespecially lethal to fry. The high mortalities caused by the disease have had a negative ... HedrickRP: Molecular comparison of isolates of an emerging fishpathogen, koi Herpesvirus, and the effect of water tempera-ture on mortality of experimentally infected koi. J Gen Virol2003, 84:2661-2668.6....
- 8
- 425
- 0
báo cáo hóa học:" Differential hRad17 expression by histologic subtype of ovarian cancer" ppt
... Young et al.: Differential hRad17 expression by histologic subtype of ovarian cancer. Journal of Ovarian Research 20114:6.Young et al. Journal of Ovarian Research 2011, 4:6http://www.ovarianresearch.com/content/4/1/6Page ... fold. hRad17 RNA expression differed by subtype. Conclusions: hRad17 is over-expressed in ovarian cancer. This over -expression varies by subtype suggesting a rolein the pathogenesis of these types. ... upregulation of hRad17 in 49.5% of ovarian cancer cases.Immunohistochemistry demonstrated that only 42% of serous and 47% of endometrioid subtypes showedoverexpression compared to 80% of clear...
- 7
- 331
- 0
báo cáo hóa học:" Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" doc
... fatigue syndrome and healthy persons: a population-based study of fatiguing illness in GeorgiaRoumiana S Boneva*, Jin-Mann S Lin, Elizabeth M Maloney, James F Jones and William C ReevesAddress: ... with a standardized list of reasons to choose from, and healthliteracy may have affected the accuracy of these data. Our study was cross-sectional in nature and does not allow forproper evaluation ... thenational average of 1% [26]. In the national survey, half of the users of muscle relaxants took them for more than a year [26]. Because joint/muscle pain in CFS is chronic, persons in our study...
- 11
- 498
- 0
Báo cáo hóa học: " Si nanowires by a single-step metal-assisted chemical etching process on lithographically defined areas: formation kinetics" docx
... NANO EXPRESS Open Access Si nanowires by a single-step metal-assisted chemical etching process on lithographically defined areas: formation kineticsAndroula Galiouna Nassiopoulou*, Violetta ... Violetta Gianneta and Charalambos KatsogridakisAbstractIn this paper, we investigate the formation kinetics of Si nanowires [SiNWs] on lithographically defined areas using a single-step metal-assisted ... ofSiNWs on lithographically defined areas on the Si waferusing a single-step MACE process based on an aqueousHF/AgNO3solution. We investigated the etch rate of Si, and the corresponding SiNW...
- 8
- 395
- 0
Báo cáo hóa học: " Organic nanofibers integrated by transfer technique in field-effect transistor devices" pot
... light-emittingmaterial in organic light-emitting field-effect transistors(OLEFETs) [21].A remaining challenge, however, is the integration ofsuch organic nanofibers into the necessary surroundingcircuitry ... 8NANO EXPRESS Open Access Organic nanofibers integrated by transfer technique in field-effect transistor devicesLuciana Tavares*, Jakob Kjelstrup-Hansen, Kasper Thilsing-Hansen and Horst-Günter ... was involved in growing of the nanofibers and developing the FETsubstrates, made the transfer technique, transferred the nanofibers, performed the electrical measurements, contributed in the interpretation...
- 8
- 279
- 0
Báo cáo hóa học: " Research Article Process Neural Network Method: Case Study I: Discrimination of Sweet Red Peppers Prepared by Different Methods" pot
... ocessingVolume 2011, Article ID 290950, 8 pagesdoi:10.1155/2011/290950 Research Ar ticle Process Neural Network Method: Case Study I: Discrimination of Sweet Red Peppers Prepared by Different MethodsSevcan ... the neural network. Theseresults are encouraging and su ggest that neural ne tworksare potentially useful for discriminating sweet red peppers processed by different methods. Furthermore, the process neural ... as an effectiveanalysis tool. The applicability of t his tool is tested for discrimination of sweet red peppers (Capsicum annuum L.) prepared by different methods such as freezing and pureeing.As...
- 8
- 375
- 0
Báo cáo hóa học: " SiC Nanowires Synthesized by Rapidly Heating a Mixture of SiO and Arc-Discharge Plasma Pretreated Carbon Black" ppt
... of the SiC nanowires 154 Nanoscale Res Lett (2009) 4:153–156123NANO EXPRESS SiC Nanowires Synthesized by Rapidly Heating a Mixture of SiO and Arc-Discharge Plasma Pretreated Carbon BlackFeng-Lei ... high-temperatureFig. 1 Schematic diagram of the apparatus for synthesis of SiC nanowires Fig. 2 SEM image and EDX pattern of carbon black after arc-discharge plasma treatmentFig. 3 XRD pattern of ... procedure. A ball-milled mixture of SiO and carbon black was used as source materials. The carbon black were pretreated in an arc-discharge plasma instru-ment in order to form loose and porous...
- 4
- 313
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfhoàng mạnh quân báo cáo khoa học công nghệ đặc điểm văn hóa kiến thức và chiến lược sinh kế của đồng bào dân tộc thiểu số tại đarkrông quảng trịbáo cáo khoa họcbáo cáo y họcbáo cáo môn họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP