báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
Báo cáo hóa học: "Adaptive robot training for the treatment of incoordination in Multiple Sclerosis" doc
... of
trials.However,noonedid,andinfactthetaskwas
well tolerated. Furthermore, there was no degradation of
performance at the end of the adaptation phase as com-
pared to the final portion of the wash-out ... wrist
restrained by means of suitable holders, and grasped the
handle of a planar robotic manipulandum [33] with
their most affected hand. The position of the...
Báo cáo khoa học: "An Automatic Method for Summary Evaluation Using Multiple Evaluation Results by a Manual Method" pptx
... zero and if greater than 0.5 it is
changed to 0.5.
Exp-4: Comparison of Yasuda’s method and
other automatic methods
In the same way as for the evaluation of
Kazawa’s method in Exp-2, we evaluated ... compared the result by
Yasuda’s method (Table 3) with that of
Kazawa’s method (in Tables 1 and 2). Yasuda’s
method could accurately estimate manual scores.
In part...
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... 21 patients at one year follow-up with
laser denervation of the dorsal facet capsule. Li et al.
8
treated 5 patients with RFA of the dorsal rami. Three
patients had durable response after ... 40% of patients
had relief for at least 12 months, and mean duration of
pain relief was 14 months. Barlocher et al.
1
treated 50
patients with cryorhizotomy of the medial bran...
báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx
... inter-
view and the parents agreed to allow their child to partic-
ipate, they were scheduled for an interview date. At the
time of the interview, a trained research assistant obtained
parental informed ... elicit information regarding the clarity and ration-
ale of the directions, the meaning of the items, the appro-
priateness of the response choices, and overa...
Báo cáo hóa học: " Innovative gait robot for the repetitive practice of floor walking and stair climbing up and down in stroke patients" pdf
... the
article and the analysis of the gathered data. CT worked on the data acquisi-
tion, the subsequent signal processing, and helped in the draft of the present
manuscript. All authors read and approved ... was
given by a regularization of the jerk [21], the third deriva-
tive of the position information.
The data relative to the marker placed on the metata...
báo cáo hóa học: "Wearable kinesthetic system for capturing and classifying upper limb gesture in post-stroke rehabilitation" pot
... the ULKG.
Sensor Characterization
The main aim of the CE sensor characterization has been
the determination of the relation between the electrical
resistance R(t) of a treated fabric sample and ... case of deformations which increase the length
of the specimen and in case of de formations which
reduce it, two local maxima greater than both the starting
value an...
Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"
... uncertain. We aimed to evaluate the efficacy of endoscopic laminoforamino-
plasty (ELFP) in the treatment of thoracic radiculopathy.
Methods: Twelve patients with radicular pain involving the ... Publisher. All rights reserved
Research Paper
Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic
radiculopathy: report of 12 cases
Scott M.W. Haufe
1,2
...
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx
... provides a clear explanation for the
inability of P450scc to cleave the side chain of vitamin
D3. Hydroxylation of the side chain of cholesterol at
the adjacent carbons C22 and C20, to produce
2 0a, 22R-dihydroxycholesterol ... synthesis by the human
placenta. Placenta 26, 273–281.
2 Guryev O, Carvalho RA, Usanov S, Gilep A & Esta-
brook RW (2003) A pathway for...
Tài liệu Báo cáo khoa học: "Incorporating Context Information for the Extraction of Terms" pdf
... of the European Chapter of the Asso-
ciation for Computational Linguistics, EACL-94,
pages 34-40.
B~atrice Daille, I~ric Gaussier and Jean-Marc Lang,.
1994. Towards Automatic Extraction of ... used for the
evaluation of the candidate string, and the amount
of information that various context carries. We said
that for this prototype we considered the adjective...
Báo cáo khoa học: YidC is required for the assembly of the MscL homopentameric pore potx
... was amplified from E. coli K12 genomic DNA, includ-
ing a C-terminal HA tag, using primers 5¢-GCGCGCGA
ATTCATGAGCATTATTAAAGAATTTCG-3¢ (forward)
and 5¢-CGCGCGGGATCCTTAAGCATAATCAGGAAC
ATCATAAGGATAACCACCAGGAGAGCGGTTATTC
TGCTCTTTC-3¢ ... were 5¢-AGCAGAATAA
CTGCTCTCCTGGTG-3¢ (forward) and 5¢-CACCAGGAG
AGCAGTTATTCTGCT-3¢ (reverse), and those for MscL
F54C were 5¢-GGGATCGATTGCAAACAGTTTGC-3¢
(forw...
Từ khóa:
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- BT Tieng anh 6 UNIT 2
- Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- chuong 1 tong quan quan tri rui ro
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật