báo cáo hóa học:" Long-term sequel of posterolateral rotatory instability of the elbow: a case report" ppt
báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx
... 5'-CACCCAGCACAATGAAGAT-3'; ACTBreverse: 5'-CA AATAAAGCCATGCCAAT-3'. Cycling condi-tions were used as described previously [17]: 95°C for 10min to activate DNA polymerase, followed ... ABCC2-dependingcisplatin resistance in NPC.ABCC2 siRNA increased the intracellular accumulation of cisplatinFigure 2ABCC2 siRNA increased the intracellular accumulation of cisplatin. (A) A ... Surowiak P, Materna V, Kaplenko I, Spaczynski M, Dolinska-Krajew-ska B, Gebarowska E, Dietel M, Zabel M, Lage H: ABCC2 (MRP2,cMOAT) Can Be Localized in the Nuclear Membrane of Ovarian Carcinomas...
- 9
- 509
- 0
báo cáo hóa học:" Three-dimensional growth as multicellular spheroid activates the proangiogenic phenotype of colorectal carcinoma cells via LFA-1-dependent VEGF: implications on hepatic micrometastasis" docx
... Cancer 2005, 41:2355-9.19. Maruo Y, Gochi A, Kaihara A, Shimamura H, Yamada T, Tanaka N,Orita K: ICAM-1 expression and the soluble ICAM-1 level forevaluating the metastatic potential of gastric ... University of the Basque Country, Leioa, Bizkaia-48940, SpainEmail: Mar a Valcárcel - valcarcelcuesta@yahoo.es; Beatriz Arteta - tirtxe@euskalnet.net; Arrate Jaureguibeitia - ajaureguibeitia@pharmakine.com; ... Martínez1, Lorea Mendoza1, Francisco J Muruzabal1, Clarisa Salado1 and Fernando Vidal-Vanaclocha*2,3Address: 1Pharmakine Ltd., Bizkaia Technology Park, Derio, Bizkaia-48160, Spain, 2Basque...
- 12
- 419
- 0
báo cáo hóa học:" An intron 9 containing splice variant of PAX2" pptx
... GTCGTGA CATGGCGAGC ACCACTCTGC CTGGTTACCC CCCTCACG TGCCCCCCACTG GCCAGGGAAG CTACCCCACC TCCACCCTGG CAGGAATG GTIntron 9GCCTG g t a g gtgacaatgc tgcagctgcc taatctaggt ggggggaact a aattgtggg tgagctgctg ... tgagctgctg a atggtctgtagtctgaggc tggggtggggggagacacaa cgtcccctcc ctgcaaacca ctgctattct g tccctctctExon 10 c t c c t t a g AG GCTGCAGTTG GTCCCTCATC CTCCCTCATG AGCAAGCCGGGGAGGAAGCT T GCAGAAGT GCCCCCTTGT ... ggggggaact a aattgtggg tgagctgctg a atggtctgtagtctgaggc tggggtggggggagacacaa cgtcccctcc ctgcaaacca ctgctattct g tccctctctExon 10 c t c c t t a g AG GCTGCAGTTG GTCCCTCATC CTCCCTCATG AGCAAGCCGGGGAGGAAGCT...
- 6
- 413
- 0
báo cáo hóa học:" Hypoglycemic and beta cell protective effects of andrographolide analogue for diabetes treatment" pot
... mechanisms of action of this promising new anti-diabetic agent arewarranted.Abbreviations A. paniculata: Andrographis paniculata; Andro: androgra-pholide; AL-1: andrographolide-lipoic acid ... insulin in the pan-creata of the glibenclamide-treated animals despite the fact that these animals had fairly large beta cell mass (Fig.3), suggesting that the ability of these beta cells to ... http://www.translational-medicine.com/content/7/1/62Page 13 of 13(page number not for citation purposes)36. Kaneto H, Kajimoto Y, Miyagawa J, Matsuoka T, Fujitani Y, UmayaharaY, Hanafusa T, Matsuzawa Y, Yamasaki Y, Hori M: Beneficial effectsof...
- 13
- 591
- 0
báo cáo hóa học:" Phase I/II open-label study of the biologic effects of the interleukin-2 immunocytokine EMD 273063 (hu14.18-IL2) in patients with metastatic malignant melanoma" docx
... andMedarex. AK and OK are employees of Merck KGaA; OK isalso an Adjunct Professor at the University of North Caro-lina at Chapel Hill, NC, USA. SDG is a former employee of Merck KGaA and an ... metastatic melanomaand renal cell carcinoma. J Immunother 2003, 26:130-138.13. Antony PA, Paulos CM, Ahmadzadeh M, Akpinarli A, Palmer DC, SatoN, Kaiser A, Hinrichs CS, Klebanoff CA, Tagaya Y, Restifo ... (IFN), had a Karnofsky performance status of ≥ 70%, and had ade-quate organ function. Patients were enrolled at least 4weeks after their last dose of prior therapy. Patients wereto have at least...
- 11
- 673
- 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc
... combination DNA and inactivated rabies virus vaccine. HumGene Ther 2001, 12:1917-1922.32. Wang S, Parker C, Taaffe J, Solórzano A, Garc a- Sastre A, Lu S: HeterologousHA DNA vaccine prime–inactivated ... elec-troporated DNA as a boost ing agent [65]. Effectivepriming may also be achievable through intr adermaldelivery of DNA as shown in a model of human skintattooing [66].In light of the scarcity of ... [18],intra-lymphatic administration [19,20], or other enhan-cing approaches such as electroporation [21], have onlypartially improved the immune re sponse achievable byDNA vaccination alone. Nevertheless,...
- 11
- 505
- 0
báo cáo hóa học: " Thai SF-36 health survey: tests of data quality, scaling assumptions, reliability and validity in healthy men and women" pdf
... Krittayaphong R, Bhuripanyo K, Raungratanaamporn O, Chotinaiwa-tarakul C, Chaowalit N, Punlee K, Kangkagate C, Chaithiraphan S:Reliability of Thai version of SF-36 questionnaire for the eval-uation ... performed the statistical analysis and drafted the manuscript. SSdesigned, managed and coordinated the study. AS partici-pated in the study conduct and manuscript preparation.All authors read and approved ... experience. Journal of the Medical Association of Thailand 2007,90:1458-1466.7. Sungkanakara C, Assanasen P, Banhiran W, Metheetrairut C:Abstracts 2nd world congress of the world association of sleep...
- 9
- 574
- 0
báo cáo hóa học: " How do medical students value health on the EQ-5D? Evaluation of hypothetical health states compared to the general population" ppt
... Participationwas voluntary and anonymous. Ethical approval wasobtained from the institutional review board.We used the German version of the EQ-5D for which data of the general population of Germany ... available for the generalpopulation of Austria, we compared our data on self-reported health of medical students with the self-reportedhealth data of a German general population sample [11]. The ... health state on a thermometer-style VASaccording to its relative rank. The VAS was bounded by the worst imaginable health state (0) and the best imaginablehealth state (100). Participants were...
- 6
- 423
- 0
Báo cáo hóa học: " Patient-cooperative control increases active participation of individuals with SCI during robot-aided gait training" pdf
... all patients, data analysis, statistical analysis, and drafted the manuscript. RR participated in the design and coordination of the studyand assisted with drafting the manuscript. All authors ... axes of the Lokomat.Data analysisSpatiotemporal variabilityTo quantify the amount of temporal and spatial varia-tions in the gait patterns during walking in the differentFigure 1 Control algorit ... capabilities of patients,particularly of patients transitioning from a non-ambula-tory to an ambulatory state during their rehabilitationprocess. Finally, we evaluated the feasibility of the pathcontrol...
- 13
- 427
- 0
Báo cáo hóa học: " Oromotor variability in children with mild spastic cerebral palsy: a kinematic study of speech motor control" docx
... markers atper-auricular areas. The y-axis is perpendicular to the frontal plane passing through markers at the foreheadand bila teral pre-auricular areas. The z-axis is ortho go-nal to x-andy-axis. ... stoppingand voicing (2 cases), backing (one case) , fronting andde-affrication (one case) , and other error (one case) .Experimental setup of Kinematic analysisDuring the Kinematic analysis task, the ... carried out the kinematic data collection and analysis. FGYparticipated in the data interpretation and the revising of this manuscript.LYY carried out the data collection and analysis. CYW carried...
- 10
- 421
- 0
Từ khóa: báo cáo hóa họctài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfhoàng mạnh quân báo cáo khoa học công nghệ đặc điểm văn hóa kiến thức và chiến lược sinh kế của đồng bào dân tộc thiểu số tại đarkrông quảng trịbáo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ