báo cáo hóa học:" The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" docx
Báo cáo hóa học: " The role of feed-forward and feedback processes for closed-loop prosthesis control" doc
... digits, and a bluetooth interface to allow real-time streaming of data to a PC for data logging. It has scored highly in terms of p atient satisfaction [ 23] and is an open-loophand, making it an ... the black blobs. This analysis indicates that approximately 12distinguishable stimuli can be perceived along the forearm.Saunders and Vijayakumar Journal of NeuroEngineering and Rehabilitation ... understanding the human-machine interface.By manipulating feedforward and feedback uncertaintywe have shown that the seemingly trivial task of grasp-ing and lifting objects employs non-trivial cognitivemechanisms....
- 12
- 503
- 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc
... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGCHJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCCHJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGAHJ1 AGAAGCTCCATGTAGCAAGGCTAGHJ2 ... Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAGASP2 CTGGATGTTGTACGTGACCGGACGATACTGTAGCATTDU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTADU2 TAGGCAGACTGACCCGGGAGCTGCTCGTACHJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTTHJ6 ... CTAGCCTTGCTAGGACATCTTCCGHJ3 CGGAAGATGTCCATCTGTTGTAGGHJ4 Bio-AAAAAACCTACAACAGATCATGGAGCTTCT5498 M. J. Dickman et al. (Eur. J. Biochem. 269) Ó FEBS 2002 The RuvABC resolvasomeQuantitative analysis...
- 10
- 672
- 0
báo cáo hóa học: "Three-dimensional kinematic motion analysis of a daily activity drinking from a glass: a pilot study" pot
... grasping the glass with all fingers (no fingers at the bottom), lifting the glass from the table and taking a drink (one swallow),placing the glass back on the table inside the marked area and ... three-dimensional kinematic analysis of the drinking task. Our approach to investigate and analyze a goal-oriented daily activity has a great clinical potential. Consequently, the next step is to use and ... grasp) and returning the hand to the initial position. The mathematical and dynamical proper-ties of kinematic data were used to determine the start and the end of each phase. Five subsequent phases...
- 11
- 294
- 0
Báo cáo hóa học: " The emerging role of insulin-like growth factor 1 receptor (IGF1r) in gastrointestinal stromal tumors (GISTs)" pdf
... Kawano K, Hanada M, Kurata A, Takeda M, Muhammad Tunio G,Matsuzawa Y, Kanakura Y, Shinomura Y, Kitamura Y: Gain of functionmutations of c -kit in human gastrointestinal stromal tumors. Science1998, ... University of Bologna, Italy.Authors’ contributionsMAP and GB: concept and design. MAP, AA and MN: writing. AA and MN:literature analysis. All authors gave final approval.Competing interests The authors ... 13:671-86.55. Pantaleo MA, Nannini M, Di Battista M, Catena F, Biasco G: Combinedtreatment strategies in gastrointestinal stromal tumors (GISTs) afterimatinib and sunitinib therapy. Cancer Treat Rev...
- 6
- 494
- 0
Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc
... 9:75http://www.translational-medicine.com/content/9/1/75Page 3 of 8REVIEW Open Access The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical settingAlessandra Maleddu1*, ... 10555].doi:10.1186/1479-5876-9-75Cite this article as: Maleddu et al.: The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting.Journal of Translational Medicine 2011 9:75.Submit ... than the others. The aim of this paper is to review the clinical significance of tyrosine kinase mutational status.Introduction Gastrointestinal stromal tumors (GIST) are rare tumors of the gastrointestinal...
- 8
- 517
- 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx
... 5¢-gagagatttgctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgctaccgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctgctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaactttgaatgggcggagggttatattgag-3¢. ... details about the role of different resi-dues of the aglycone-binding site in the stabilization of ESà and the interdependence between the binding of aglycone and the positioning of glycone in ... delineates a channel that could be the pathway for the release of the aglycone in the glyco-sylation step and the entrance of the water moleculeinvolved in the hydrolysis of the covalent intermediate[17]....
- 12
- 731
- 0
Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx
... Renata Piccoli, forcritical reading the manuscript and helpful suggestions; and to Dr Valeria Cafaro, Aurora Bracale, AntonellaAntignani and Sonia Di Gaetano for preparing some of the RNase variants ... through rotation of the RNase around its major axis (rotationangle ‘r’) and variation of the inclination (inclination angle ‘i’) withrespect to the plane of the membrane (parallel to the xy plane).Cter ... fordestabilizing and eventually permeating membranes, and that intracellular membranes play a decisive role in defining the antitumor action of an RNase.Experimental proceduresAssays with membranesSynthetic...
- 11
- 643
- 0
Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx
... osmoregulation and sporulation. Isola-tion and characterization of yeast mutants blocked at various sta-ges of transport pathways are an invaluable method forunravelling the molecular details of vacuolar ... syndrome and adipocytokinesY. MatzuzawaDepartment of Internal Medicine and Molecular Science, GraduateSchool of Medicine Osaka University, Osaka, JapanVisceral fat accumulation plays crucial roles ... the generation of pre-b-HDL. Ourgoal was to characterize gene regulatory networks and ABCA1associated lipid pathways in human macrophages in cardiovascu-lar disease and under atherogenic and...
- 7
- 749
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... (a) In the absence of one ormore integral membrane subunits the majority of the subunits in the peripheral-subcomplex are accumulated in a stable form, and m ost likely already associated in ... subunit of complex I (NDUFB6) served as a nother identification of the complex at the position o f the histochemical stain in the left panel. Antisera against the SDHC subunit of complex II and against ... the amino acid sequences of the known mammalian ESSS proteins reveals a high degree of conservation in the C-terminal domain (including the transmembrane region), but a significant number of differ-ences...
- 9
- 622
- 0
Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx
... This indicates thatN-glycans, in particular their terminal trimming, are important for the GABA-uptake activity of GAT1. They play a regulatory role in the GABAtranslocation by affecting the affinity ... used for the immunostaining. The protein bands obtained in westernblotting were analyzed by phosphoimager scanning. The total protein of the cell surface and intracellular bands of each wild ... areinvolved in regulating the GABA translocation of GAT1, but not in binding of GAT1 to GABA.Transport of GABA by GAT1 across the cell mem-brane is driven by an electrochemical gradient of Na+and...
- 14
- 654
- 0
Từ khóa: the role of termites and ants in soil modificationthe role of language and communication in conflict managementthe role of nature and nurture in language acquisitionthe role of transport and communication in economic development of nigeriathe role of transportation and communication in economic development of a countrythe role of termites and ants in soil modification a reviewdescribe the role of school and teachers in shaping one personalitythe role of transportation and communication in national developmentthe role of prices as signals in a competitive marketdescribe the role of school and teachers in shaping ones personalitythe role of music and sound in filmthe role of communication and training in the workplacethe role of language and communication in human cognitionthe role of attitudes and motivation in secondforeign language learningexplain the role of management information system in a multinational business organizationBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ