Báo cáo hóa học: " A Korean version of the Oral Impacts on Daily Performances (OIDP) scale in elderly populations: Validity, reliability and prevalence" potx
... property of being
in
one of these states
The simulation proceeds as in the relational grammar
example. Each configuration of the stack corresponds to
a level in an RG derivation. Initially, the ... deterministic finite automaton. We will thus use the
ordinary 6 notation for the transition function of the au-
tomaton. Nodes of the graph correspond to state...
... first, the
activating interaction of AdoMet with TS may attenuate
the changes in the flux of threonine due to a modification of
the level of AdoMet. Indeed, upon an increase in the level of
AdoMet, ... concentration of
NAD
+
at time, t. A small error is made in this calculation as
a consequence of the time delay in the enzymatic chain.
Subtraction of...
... prepositions place a
constraint on the position of the LO relative to
a particular side of the RO. In the case of the
intrinsic interpretation (see section ) of a predi-
cation such as " ;the ... considerations including: the
spatial context (the spatial extent and content of
the scene described); and the absolute and relative
sizes of t...
... phase contrast and fluorescence photo-
graphs of selected field of cells obtained under the same
magnification and contrast acquisition characteristics, and
using the autofluorescence of the anthracycline ... high AnnexinV-Fluos
staining and low propidium-iodide staining are clearly more abundant
after treatment with daunorubicin (D).
Fig. 4. Quantitative determination of t...
... 119–125.
25 Janecek S, Svensson B & MacGregor EA (2003)
Relation between domain evolution, specificity, and
taxonomy of the a- amylase family members containing
a C-terminal starch-binding domain. Eur ... T, Takata H, Kaneko H & Okada S
(2000) Introduction of raw starch-binding domains into
Bacillus subtilis a- amylase by fusion with the starch-
binding domain of Bacill...
... RELATION:P to S EXAMPLE
parallel brother in addition
detail father in particular
inference son as a result
summary multiple sons in SL~n
reformulation
father and son in other words
contrast ...
2b )The reason for the danger is
2c )The reason is
2d )The problem is
2a) is an explicit indication of evidence; b) and
c) have a phrase indicating a causal connec...
...
Tonology. Kaitakusha, Tokyo.
Kaplan, Ronald and Joan Bresnan (1982) Lexical
Functional Grammar: A Formal System for
Grammatical Representation. in The Mental
Representation of
Grammatical ... syntactic and prosodic
labelling, thereby guaranteeing the declarative
nature of the syntax-prosody interface. In turn,
prosodic labels are associated with a set of
equa...
... thioredoxin-like domains (abb¢) are
arranged like a cloverleaf. A long C-terminal tail folds
back and makes contacts with the a and b¢ domains
[10]. This capping function of the C-terminal tail may
have assisted ... intermediate roles in catalysis and binding, and the
a domain functions primarily to bind substrates. How-
ever, the unequal contributions to binding a...
... mutations on RNA-binding and
cleavage assays were evaluated.
A RNA binding assay of the different mutants was
performed using native MS, as indicated above. In all
cases, the relative binding percentages ... (kid A5 5G)
PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G)
PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G)
PT69G(+) G...
... actually made at that point. This allows it
to mark the actual move in the given history with
certain tactical details, using the implicit
assumption that whoever made the moves had the same ... "rational reconstruction'~
that'is, an attempt to present a slightly cleaner,
more general method, based on Davey's ideas and
performing the same specific...