báo cáo hóa học: " Construction and validation of a short-form Quality-Of-Life Scale for Chinese Patients with Benign Prostatic Hyperplasia" pptx
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
... shows a four-category data configu- 247 Development and Use of a Gold-Standard Data Set for Subjectivity Classifications Janyce M. Wiebet and Rebecca F. Bruce:[: and Thomas P. O'Harat tDepartment ... reliably annotated gold standard to support experimenting with such applications. This research is also a case study of ana- lyzing and improving manual tagging that is applicable to any tagging ... ing manual results in as much as a 16 point im- provement in pairwise Kappa values, and raises the average agreement among the judges to a Kappa value of over 0.87 for the sentences that can...
- 8
- 354
- 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... were as follows:forward primer, GTT GGA ATT CCA TCA TCA TCATCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAGGAG GGA TAT GGG GAA C. The PCR reaction wasdone ... T. reesei DNA with the following primers: forward, GGG GAC AAGTTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGTCAG GTC CCT CTC G; and reverse, GGG GAC CACTTT GTA CAA GAA AGC TGG GTC A GT GGT GGTGGT ... oxidase, Japanese patent 61115488.37 Yamada Y, Tawara Y & Yoshika H (1983) Production of heat-resistant polyphenol oxidase, Japanese patent60062980.38 Abdel-Raheem A & Shearer CA (2002)...
- 14
- 650
- 0
Tài liệu Báo cáo khoa học: "DESIGN AND IMPLEMENTATION OF A LLXICAL DATA BASE " docx
... requirements" and has to do with the complexity of the task of creating a lexical entry. It can roughly be viewed as a measure of the time it takes to create a new lexical entry, and of the amount of ... just a particular set of grammatical features such as category, gender, number, person, case, etc. A lexeme contains all the information shared by all the flectional forms of a given lexical ... yet another example of the "historicist approach" typical of classical transformational generative grammar, which assumes that synchronic processes recapitulates many of the diachronic...
- 8
- 535
- 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... was inhibited not only byunlabeled Bip-Pro itself, but also by well known sub-strates of H+⁄ peptide cotransporters, such as Gly-Sar,Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala,d-aminolevulinic ... 5907Synthesis and characterization of a new and radiolabeledhigh-affinity substrate for H+/peptide cotransportersIlka Knu¨tter1, Bianka Hartrodt2,Ge´za To´th3, Attila Keresztes3, Gabor ... and conformation of recombinant membrane transporters[19], labeled substrates and inhibitors with a broadrange of affinity to the respective protein are alsoessential tools. In the course of...
- 10
- 490
- 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc
... (5¢-GGCCTCATGAAGAAAAAGGTCGTCATAATT-3¢), and TG101 (5¢-GGCCAAGCTTCTAGAACTTGAGAACCCTAGC-3¢) (for the P. horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTAGTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAACTTCAAAACCCTGGC-3¢) ... tube and sealed with Parafilm. For lower temperatures, the tube wasplaced in the respective freezer and standard activity assayswere performed after 1 month. At higher temperatures, a CoADR from ... act-ing as a CoADR. This is only the second demonstra-ted CoA reductase activity, and the first appearance of this activity in both the Archaea and in a strict anaer-obe. While the best known small...
- 12
- 420
- 0
Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf
... of application domain. • Development of a manually-bracketed corpus (tree- bank) of the domain. • Creation of a grammar with a large coverage of a blind test set of treebanked text. Statistical ... range of sentence types and the availability of large corpora of computer manuals. We amassed a corpus of 40 million words, consisting of several hundred computer manuals. Our approach in attacking ... possible fea- Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals Ezra Black John Lafferty Salim Roukos <black I j laff ] roukos>*watson,...
- 8
- 562
- 0
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc
... protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF9 of A. thaliana.These proteins b elong to the 2Cys-Prx subfamily. A ll plan t2Cys-Prx proteins, except BAS1 of barley, ... X-ray ® lm at )20 °Cor,when using an intensifying s creen, at )80 °C.RNA for Northern analyses was isolated as describedabove and separated in a 1.3% agarose/formaldehyde gel.The RNA was ... were separated by HPLC and some of themwere totally or partially analyzed by Edman sequencing and/ or by MALDI-TOF mass spectrometry ( Fig. 2).Computer database searches based on the amino-acidsequences...
- 11
- 608
- 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt
... TAACCCCAATCTAGACAGTCCARA358 CTGCTGTAATAATGGGTAGAAGGARA439 GGAATTCCATATGCGTATTATGGCCAGARA440 TATTTACTCGAGAATCCCCTCCTCAGCARA444 CGGGATCCACCGTGAAAAAGAAAGAATTGTCARA451 GAATTCATAAAGAAGCTTTGTCTGAAGCARA456 ... CGTGAATTCACCGAGCATGTCACCAAAGCCARA477 AATCAGAATGGGATCCGGTGAARA486 CGGCTGACATTCTGATTGACTTGGACGGARA487 CAATCAGAATGTCAGCCGGTGACACAGGARA509 CC AGT CAT GAT A AG CCT GTG TCA CCGARA510 CGG TGA CAC ... CGGCGCGTCATATGGCCAGTCATGATAARA457 TGATACGCATATGTCACCGGCTGGCARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCACARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAGARA460...
- 14
- 594
- 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
... enzyme has a tetrameric conformation with a molecularmass of 155 kDa. The catalytic activity of the enzyme increases up to100 °C, and a half-life of 11 min at this temperature indicates its ... (5¢-GCGCGGGATCCTCATTTAAGCATGAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences). In order tointroduce an NcoI restriction site, an extra alanine codon(GCA) was ... 1 L Luria–Bertani medium with kanamycin and spectinomycin (both 50 mgÆL)1) in a 2-L conical flask and incubated in a rotary shaker at 37 °C until a cell density of A 600¼ 0.6 was reached. The...
- 8
- 415
- 0
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf
... blot analysis of total genomic DNA from tomatoplants. Fifty micrograms of DNA was digested overnight with restriction enzymes and separated on a 1% agarose gel. M, sizestandard; lane 1, Bam HI-digested ... scions. A strong candidate for a transmissible jasmonate signal isthe JA-conjugate, MeJA. The volatile ester can diffusethrough membranes and c an be found in the headspaceabove w ounded leaves ... application of JA. These experiments demonstrate that individual mem-bers of the jasmonate family are involved – at least inArabidopsis – in different signalling pathways.An Arabidopsis(jar1)mutantwithadefectinthejasmonate...
- 8
- 458
- 1
Từ khóa: construction and management of a lying in institution and training school for midwives and midwifery nursesthe evolution and implementation of a self help program for family caregiversmodeling simulation and control of a power assist robot for manipulating objects based on operator s weight perceptionbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfnguyễn văn chính 2012 cấu trúc và giải cấu trúc bản sắc văn hóa hà nội construction and deconstruction of hanoi s cultural identity sakura bản sắc văn hóa hà nội nguyen sakura blogspot comBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP