báo cáo hóa học: "Validity and reliability of a new, short symptom rating scale in patients with persistent atrial fibrillation" pot
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... sub-strates of H+⁄ peptide cotransporters, such as Gly-Sar,Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala,d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide(all 100 lm, Table 1). Glycine, ... JC, Fujita T, Liang R, Ganapathy V & Lei-bach FH (1998) Identification of a potential substratebinding domain in the mammalian peptide transportersPEPT1 and PEPT2 using PEPT1-PEPT2 and PEPT2-PEPT1 ... chain in a short intramolecular distancefrom the a- carbon atom, is the N-terminal amino acid and l-Proline (l-Pro) is the C-terminal amino acid.The resulting compound, Bip-Pro, was tested with regard...
- 10
- 490
- 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... follows:forward primer, GTT GGA ATT CCA TCA TCA TCATCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAGGAG GGA TAT GGG GAA C. The PCR reaction wasdone as described above. ... tyrosinase was alsoinactivated completely within 20 min [40]. In general,mammalian and plant-derived tyrosinases are not verythermostable; even a short incubation at 70–90 °C inac-tivates ... rounds and tested for tyrosinase activity with a plate assay. In the assay plates, Trichoderma minimal med-ium [19] with 2% lactose as a carbon source, 1% potassiumphthalate as a buffering agent...
- 14
- 650
- 0
Tài liệu Báo cáo khoa học: "DESIGN AND IMPLEMENTATION OF A LLXICAL DATA BASE " docx
... defined as a set of syntactic and semantic features shared by one or several morpho-syntactic elements. Roughly speaking, it contains the kind of information one expect to find in a standard ... INTRODUCTION It has been traditionally assumed by computational linguists and particularly by designers of large natural language processing systems such as machine translation systems that the lexicon ... large natural language processing systems such as machine translation systems, and compares it with the morpheme-based conception of the lexicon traditionally assumed in computational linguistics....
- 8
- 535
- 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR are numbered and distinguished from each other by alternate highlighting in ... and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG(31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1). A TATA box was identified 28 bp upstream from thecDNA sequence.The ... 178 amino acids, with a calculated molecular mass of 20.5 kDa and a theoretical pI of 9.83.The mature peptide contains a cysteine residue and a potential N-linkedglycosylation site that are not...
- 12
- 511
- 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc
... (5¢-GGCCAAGCTTCTAGAACTTGAGAACCCTAGC-3¢) (for the P. horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTAGTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAACTTCAAAACCCTGGC-3¢) for the P. furiosus CoADR.The N terminus of ... to act as an NADH oxidase in vivo, instead act-ing as a CoADR. This is only the second demonstra-ted CoA reductase activity, and the first appearance of this activity in both the Archaea and in ... isoalloxa-zine ring resulting in a loss of absorbance at thesewavelengths. During the addition of the first equivalent of NADPH there is a decrease in absorbance at460 nm with a concomitant increase...
- 12
- 420
- 0
Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf
... provement in parsing accuracy. Sample mappings from the terminals and non- terminals of our grammar to those of the Lancaster tree- bank are provided in Table 5. For ease of understanding, we ... hand, and have thus experi- mented with only a small number of paramcterizations. Constrained training: The Inside-Outside algo- rithm is a special case of the general EM algorithm, and as ... tree), rather that in terms of the actual nonterminals of the grammar. It is in this manner that we can obtain efficient and reliable estimates of our parameters. Since the grammar is very detailed,...
- 8
- 562
- 0
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc
... identity with the BAS1 protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF9 of A. thaliana.These proteins b elong to the 2Cys-Prx subfamily. A ll plan t2Cys-Prx proteins, ... MareÂchal, P.,Miginiac-Maslow, M. & Meyer, Y. (1994) Arabidopsis thalianaNADPH thioredoxin reductase: cDNA characterization and expression of the r e combinant protein in Escherichia ... X-ray ® lm at )20 °Cor,when using an intensifying s creen, at )80 °C.RNA for Northern analyses was isolated as describedabove and separated in a 1.3% agarose/formaldehyde gel.The RNA was...
- 11
- 608
- 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt
... TATTTACTCGAGAATCCCCTCCTCAGCARA444 CGGGATCCACCGTGAAAAAGAAAGAATTGTCARA451 GAATTCATAAAGAAGCTTTGTCTGAAGCARA456 CGGCGCGTCATATGGCCAGTCATGATAARA457 TGATACGCATATGTCACCGGCTGGCARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCACARA459 ... CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCACARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAGARA460 CGTGAATTCACCGAGCATGTCACCAAAGCCARA477 AATCAGAATGGGATCCGGTGAARA486 CGGCTGACATTCTGATTGACTTGGACGGARA487 ... -’lacZ cat pLG29 fi 168T+OligonucleotidesARA28 CCTATTGAATTCAAAAGCCGGARA253 TAACCCCAATCTAGACAGTCCARA358 CTGCTGTAATAATGGGTAGAAGGARA439 GGAATTCCATATGCGTATTATGGCCAGARA440 TATTTACTCGAGAATCCCCTCCTCAGCARA444...
- 14
- 594
- 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
... (5¢-GCGCGGGATCCTCATTTAAGCATGAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences). In order tointroduce an NcoI restriction site, an extra alanine codon(GCA) was introduced ... was transformed with pWUR78 and a single colony was used to inoculate5 mL Luria–Bertani medium with kanamycin and spectino-mycin (both 50 lgÆml)1) and incubated overnight in a rotaryshaker ... rotaryshaker at 37 °C. Next, 1 mL of the preculture was used toinoculate 1 L Luria–Bertani medium with kanamycin and spectinomycin (both 50 mgÆL)1) in a 2-L conical flask and incubated in a rotary shaker...
- 8
- 415
- 0
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf
... application of JA. These experiments demonstrate that individual mem-bers of the jasmonate family are involved – at least in Arabidopsis – in different signalling pathways.An Arabidopsis(jar1)mutantwithadefectinthejasmonate ... t heyare capable of mediating a response by regulating geneexpression [6,7]. Analysis of Arabidopsis thaliana mutantsimpaired in either JA biosynthe sis or signalling, gave a deeper insight ... aremediated by MeJA through JA, indicating that MeJA is notamediatoronitsowninthisparticularsystem.On the other hand, OPDA and JA can induce identicalgenes a s w ell as d istinct s ets o f t arget...
- 8
- 458
- 1
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ