báo cáo sinh học:" The effects of performance appraisal in the Norwegian municipal health services: a case study" pdf
báo cáo sinh học:" The effects of performance appraisal in the Norwegian municipal health services: a case study" pdf
... Kirkpatrick DL: Training and Performance Appraisal - Are they Related?Improving Employee Performance Through Appraisal and Coaching 2006.65. Kuvaas B: Performance Appraisal Satisfaction and ... five-pointLikertscale(where1=stronglydisagreeand5=strongly agree).Figure 1 An exploration of the effects of performance appraisal in municipal health services. How goal setting, feedback and activeparticipation in performance appraisal together ... position in the organi-zation may be a contributing cause in these differences. In Norway, the nurses have the same education as their man-agers, and very few of the m anag ers of the municipal health service...
- 12
- 572
- 0
Báo cáo sinh học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot
... The University of Sydney, Westmead, New South Wales, Australia and 4Department of Medicine, University of Calgary, N.W. Calgary, Alberta, CanadaEmail: Haran Sivakumaran - haran.sivakumaran@qimr.edu.au; ... transactivation (the SF2 clone of one-exon tat). The values at the bases of the columns indicate the number of times that particular Tat amino acid sequence was scored in the entire sample set. An asterisk ... The core domainmutation has been reported to suppress but not eliminatetransactivation ability [15-17], and R52 participates in the binding of Tat to TAR and is involved in the nuclear local-isation...
- 5
- 317
- 0
Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx
... III and Daniel Marcu. 2006. Domain adap-tation for statistical classifiers. In Journal of Artifi-cial Intelligence Research.Hal Daum´e III. 2007. Frustratingly easy domain adap-tation. In ... Liang Huang, Yajuan L¨u, and Qun Liu.2008. A cascaded linear model for joint chineseword segmentation and part -of- speech tagging. In Proceedings of the 46th Annual Meeting of the As-sociation ... ACL and AFNLPAutomatic Adaptation of Annotation Standards:Chinese Word Segmentation and POS Tagging – A Case StudyWenbin Jiang†Liang Huang‡Qun Liu††Key Lab. of Intelligent Information...
- 9
- 404
- 0
báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx
... organ-izing, leading and controlling. Planning involves defininggoals and mapping out ways to reach them; organizingentails arranging and coordinating human, material andinformation resources aimed ... that eachmanager received for each of the seven factors was calcu-lated from the mean of the summed items for that varia-ble. This allows one to treat the data as interval datameasuring a latent ... defined a list of health man-agement competencies and performance indicators toassist in the development of training programs in medicalmanagement. These related to the delivery of health care,financial...
- 7
- 503
- 0
báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot
... purposes)remain, further increasing turnover [9]. The implications of these findings are therefore alarming for the provision of health care in South Africa now and in the future, giventhat we are already ... Pillay R: Effect of organisational structure and managerialpractices on the clinical behavior and job satisfaction of pri-mary healthcare doctors as knowledge workers, in the man-aged healthcare ... Adams A, Bond S: Hospital nurses' job satisfaction, individualand organizational characteristics. Journal of Advanced Nursing2000, 32(3):536-543.41. Kaplan RA, Boshoff AB, Kellerman AM:...
- 10
- 514
- 1
Báo cáo sinh học: " Therapeutic effects of pyrrolidine dithiocarbamate on acute lung injury in rabbits" ppt
... and advising data analysis aswell as writing manuscriptJH: making study plan and advising data analysis aswell as writing manuscriptAll authors read and approved the final manuscriptAcknowledgements The ... -80°C for the measure-ments of TNF -a and ICAM-1 assay and isolation of PMNs. The same volume of fluid was replaced in allanimals after sampling. The superior lobe and inferiorpart of the right ... and Use of Laboratory Animals. The rab-bits were anesthetized with intravenous injection of 20%urethane at the dose of 5 ml/Kg. The femoral vein andhomo-lateral femoral artery were separated,...
- 9
- 799
- 0
Báo cáo khoa học: Different roles of functional residues in the hydrophobic binding site of two sweet orange tau glutathione S-transferases pdf
... (5¢-to3¢) MutantGSTU1 E117K-for: AAGACATGGACCACAAAGGGAGAAGAGCAGGAGE117K-rev: TGTGGTCCATGTCTTCGTCGAAGCATCRKIGSTU2 P89R-for: TGGCTTCCCTCTGATCGCTACCAGAGAGCTCAAP89R-rev: ATCAGAGGGAAGCAATGGAGCCTTGTCRKVGSTU1 ... TTGCTTCCCTCTGATCCCTACCAGAGAGCTCAAR89P-rev: ATCAGAGGGAAGCAATGGAGCCTTGTCPEIPEI E117K-for: TTTGGAAAGTCCAGCATTGAGGCTGAGTGCCCCE117K-rev: GCTGGACTTTCCAAATGTCTCATAPKIFunctional role of the GST H-site ... 7008–7020.25 Axarli I, Dhavala P, Papageorgiou AC & Labrou NE(2009) Crystallographic and functional characterization of the fluorodifen-inducible glutathione transferase fromGlycine max reveals an active...
- 8
- 421
- 1
Báo cáo khoa học: Identification of functional domains in the formyl peptide receptor-like 1 for agonist-induced cell chemotaxis doc
... Theseresults, in addition to the binding data obtained with125I-labeled W peptide, indicate that the chimeric recep-tors are indeed expressed on the surface of HEK293 cellsand are capable of coupling ... amyloid A (SAA) [9], a fragment of the neutrophil antibacterial granule pro-tein cathelicidin LL37 [10], and a peptide derived fromhuman prion protein [11]. The capacity of FPRL1 tointeract with ... substituting the segments in FPR with following corresponding parts in FPRL1: the N-terminus and N-terminal half of the first TM (A: chimera C), the C-terminal half of the first TM through the second...
- 10
- 366
- 0
Báo cáo khoa học: Essential roles of lipoyl domains in the activated function and control of pyruvate dehydrogenase kinases and phosphatase isoform 1 pot
... kinase is reachedwhen < 10% of the lipoyl groups in the assembled complexare acetylated. Near-maximal stimulation of the kinaseactivity is attained with an NADH/NAD+ratio of 0.1 andacetyl-CoA/CoA ... domains in the activated functionand control of pyruvate dehydrogenase kinasesand phosphatase isoform 1Thomas E. Roche, Yasuaki Hiromasa, Ali Turkan, Xiaoming Gong, Tao Peng, Xiaohua Yan,Shane ... the ATP-usingC-terminal domains interacting near the base of that side of the wedge outside; the N-terminal domains form the outside of the wedges. The wedge pockets have an extended seamthat...
- 7
- 385
- 0
Báo cáo khoa học: Identification of domains involved in the allosteric regulation of cytosolic Arabidopsis thaliana NADP-malic enzymes ppt
... ME2GFP-F(5¢-CACCATGGGAAGTACTCCGACTGAT-3¢) andME2GFP-R (5¢-AGCCCTGTGTACAGAAACTACCGT-3¢)and ME3GFP-F (5¢-CACCATGGGCACCAATCAGACTCAG-3¢) and ME3GFP-R (5¢-AGTCCTGTCTACAGAAACTTCCGT-3¢), respectively. The ... one catalytic and the other allo-steric, as in the case of NADP-ME3 (data not shown). The Krvalues obtained (Table 1) indicate that the malate allosteric site of ME2.3 and ME3.2¢ displayslower ... fumarate, malate and aspartate are allinvolved in the modulation of NADP-ME activity.Nevertheless, although these compounds are structur-ally similar, NADP-ME2 and NADP-ME3 are able todistinguish...
- 13
- 360
- 0
Từ khóa: báo cáo sinh học haythe role of viral integration in the development of cervical cancerbáo cáo sinh học phân tửin the minds eye julian hochberg on the perception of pictures films and the worldthe role of capital market in the development of nigerian economyNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ