báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf
báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf
... purposes)Human Resources for HealthOpen AccessResearch The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and ZambiaAnnette Mwansa Nkowane*1, ... monitoring and evaluation) and the same proportion was involved in AFPsurveillance. On the other hand, in Zambia, nurses and midwives were involved in the full range of functions forSIAs and AFP ... their roles and functions in polio eradication and measles elimination programmes.Methods: Nurses and midwives practising in four selected districts in Sudan and in Zambia completed a self-administered...
- 8
- 628
- 0
báo cáo sinh học:" The role of regulation in influencing income-generating activities among public sector doctors in Peru" doc
... surround-ing dual practice are about medical practice generallyrather than dual practice as an isolated activity.An important aspect of regulation is its potential role in addressing the type of ... and increasing competition in this market and undermining individuals' income earning ability.Another manifestation of these pressures in this marketwas the 'exploitative' conditions ... the present situation, as highlighted in the findings, is the deregulated market in medical practice and the difficulties associated with earning a living in suchan unrestrained and competitive...
- 8
- 496
- 0
báo cáo sinh học:" The role of leadership in HRH development in challenging public health settings" potx
... A national HR policy has been finalized, and work on a 10-year strategic plan has begun.Other initiatives include establishing and rehabilitatingtraining programs and institutions in Sudan (which ... Direc-torate of Human Resources put in place a national regis-tration system and created a database that details the training and background of 24 500 health workers. A semi-autonomous board was established ... Noormal's approach to achieving the gains made by the Directorate of Human Resources has been character-ized by a process of reaching consensus and developing and instilling a shared vision. Ideas and...
- 7
- 571
- 0
báo cáo sinh học:" The role of pharmacists in developing countries: the current scenario in Pakistan" potx
... Masood1 and Asrul Akmal Shafie1Address: 1Social and Administrative Pharmacy, School of Pharmaceutical Sciences, Universiti Sains Malaysia, Penang, Malaysia and 2Department of Pharmacy, University ... pharmacies because of the isola-tion and lack of recognition of pharmacists as health careprofessionals. The lack of trained personnel and the resulting lack of contact of pharmacists with the ... first institution to start a pharmacy depart-ment; in 1964 a Department of Pharmacy was establishedat the University of Karachi. The pharmacy programme was initiated as a three-yearbaccalaureate...
- 6
- 413
- 0
Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc
... 9:75http://www.translational-medicine.com/content/9/1/75Page 3 of 8REVIEW Open Access The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical settingAlessandra Maleddu1*, ... the extracellular side of the receptor, a trans-membrane portion and an intracellular part containingtwo tyrosine kinase domains: one with an adenosine tri-phosphate (ATP) binding region and ... 16:97-101.43. Wakai T, Kanda T, Hirota S, Ohashi A, Shirai Y, Hatakeyama K: Lateresistance to imatinib therapy in a metastatic gastrointestinal stromaltumour is associated with a second KIT mutation....
- 8
- 517
- 0
Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx
... Renata Piccoli, forcritical reading the manuscript and helpful suggestions; and to Dr Valeria Cafaro, Aurora Bracale, AntonellaAntignani and Sonia Di Gaetano for preparing some of the RNase variants ... through rotation of the RNase around its major axis (rotationangle ‘r’) and variation of the inclination (inclination angle ‘i’) withrespect to the plane of the membrane (parallel to the xy plane).Cter ... fordestabilizing and eventually permeating membranes, and that intracellular membranes play a decisive role in defining the antitumor action of an RNase.Experimental proceduresAssays with membranesSynthetic...
- 11
- 643
- 0
Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx
... osmoregulation and sporulation. Isola-tion and characterization of yeast mutants blocked at various sta-ges of transport pathways are an invaluable method forunravelling the molecular details of vacuolar ... syndrome and adipocytokinesY. MatzuzawaDepartment of Internal Medicine and Molecular Science, GraduateSchool of Medicine Osaka University, Osaka, JapanVisceral fat accumulation plays crucial roles ... the generation of pre-b-HDL. Ourgoal was to characterize gene regulatory networks and ABCA1associated lipid pathways in human macrophages in cardiovascu-lar disease and under atherogenic and...
- 7
- 749
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... (a) In the absence of one ormore integral membrane subunits the majority of the subunits in the peripheral-subcomplex are accumulated in a stable form, and m ost likely already associated in ... subunit of complex I (NDUFB6) served as a nother identification of the complex at the position o f the histochemical stain in the left panel. Antisera against the SDHC subunit of complex II and against ... the amino acid sequences of the known mammalian ESSS proteins reveals a high degree of conservation in the C-terminal domain (including the transmembrane region), but a significant number of differ-ences...
- 9
- 622
- 0
Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx
... This indicates thatN-glycans, in particular their terminal trimming, are important for the GABA-uptake activity of GAT1. They play a regulatory role in the GABAtranslocation by affecting the affinity ... areinvolved in regulating the GABA translocation of GAT1, but not in binding of GAT1 to GABA.Transport of GABA by GAT1 across the cell mem-brane is driven by an electrochemical gradient of Na+ and ... oligosaccharide side-chainsare important for the GABA transport activity.1-Deoxymannojirimycin inhibits the GABA-uptake of GAT1 In order to gain further insight into the role of the terminal structures...
- 14
- 654
- 0
Tài liệu Báo cáo khoa học: The role of the SEA (sea urchin sperm protein, enterokinase and agrin) module in cleavage of membrane-tethered mucins pdf
... GAACGATGTCATCTTCCGAGA AGGTTACA CTT TAGAGCACGAC-3¢ and M12FREG-R (antisense) 5¢-GTGCTCTAAAGTGTAACCTTCTCGGAAGAT GACATCGTT CTTGACCACGATGCTACCGT TGAGCAATCTCCGAATGTTCACCCCTCTATACTGAGGAAGATTA)3¢ (AF147790 965–1061) ... 3-SEA-F(sense) 5¢-GGACTAGTAGATGTAGTGGAGACCGAG-3¢(AF143371 180–198), 3-SEA-R (antisense) 5¢-CCGCTCGAGTCAGGCTTAAAACACAGG-3¢ (AF143371 513–530),12-SEA-F 5¢-GGACTAGTGGAAAAACTCAAGGCCACTTTAGG-3¢ ... to alanine doesnot impair cleavage. Comparison of the relative inten-sity of the noncleaved and cleaved forms of the S ⁄ A, G ⁄ A and F ⁄ A mutants suggests that the S ⁄ A mutationhas the...
- 11
- 605
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP