báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx
... crystallinity rather than adsorption on the enzymatic rate. Thus, the cellulase activity and initial rate data obtained from varioussamples may provide valuable information about the details of the ... compilation ª 2010 FEBS 1577 Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate Me´lanie Hall, Prabuddha Bansal, Jay H. Lee, Matthew J. Realff and Andreas S. BommariusSchool ... no impact on the crystallin-ity of untreated Avicel.Multivariate statistical analysis of X-ray data The CrI of cellulose samples was also calculated by quanti-fying the contribution of amorphous...
- 12
- 554
- 0
báo cáo hóa học:" Is there a relationship between factor V Leiden and type 2 diabetes?" doc
... http://www.translational-medicine.com/content/7/1/ 52 Page 3 of 4(page number not for citation purposes)Statistical analysisData are expressed as mean ± standard deviation (SD) oras number and percentage where appropriated. Statisticalanalysis ... linking between FVL gene variant,diabetes and atherothrombosis and other vascular complications, although data on largerpopulation are needed; this aspect may be another relevant topic of research ... FVL gene variant, diabetes and athero-Table 2: Prevalence of diabetes or IGT in subjects with VTE and with or without FVL.Patients with VTE and FVL (n. 64) Patients with VTE and without FVL...
- 4
- 594
- 0
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
... working as nurses at 3 years. An analysis of NHSPath model of job satisfaction, future intentions and nursing at 18 months and 3 yearsFigure 1Path model of job satisfaction, future intentions and ... factor analysis was con-ducted in SPSS version 15 on job satisfaction data at 6 and 18 months using principal component analysis with var-imax rotation and Kaiser normalization to ascertainwhether ... design,data collection and interpretation. PG provided intellec-tual and theoretical input for the paper and interpretation of the findings. All authors were involved in revising the manuscript and...
- 12
- 530
- 0
báo cáo sinh học:" Training evaluation: a case study of training Iranian health managers" docx
... level of capability in their job. Then they rated their satisfactionwith each technique on a four-point scale (not at all satis-Importance of ways of learning about health planning and managementFigure ... formiddle-level health managers [21]. The National Public Health Management Centre (NPMC) was established as a national centre for training and research in health plan-ning and management, but until ... from training mentors and line man-agers.This paper discusses the findings of an evaluation of the training conducted in Leeds and Tabriz designed to buildthe capacity of Iranian management and...
- 14
- 562
- 0
báo cáo sinh học:" Migration as a form of workforce attrition: a nine-country study of pharmacists" pptx
... (South Africa) and MEDACT (UK)19. Labonte R, Packer C, Klassen N: Managing health professional migration from sub-Saharan Africa to Canada: a stakeholderinquiry into policy options. Human Resources ... the national research coordinators: Brooke Myers, Australia; Mamunur Rashid, Bangladesh; Maja Kovacevic, Croatia; Mohammed Atef Abd El Hakim, Egypt; Suresh Panthee and Ganesh Subedi, Nepal; ... CentralPage 1 of 10(page number not for citation purposes)Human Resources for HealthOpen AccessResearch Migration as a form of workforce attrition: a nine-country study of pharmacistsTana Wuliji*1,2,...
- 10
- 382
- 0
báo cáo sinh học:" Experience with a "social model" of capacity building: the Peoples-uni" ppt
... improve the capacity of their own employeesor of those who will pay them to provide an educationalprogramme of some sort. A variant of the self-learn modelcan be found as part of the third ... plan the initiative. After the creation of a charitable trust in the United Kingdom, some of these colleagues became trustees, and others becamemembers of an international advisory group or a ... occupationare shown in Table 1. A fee of USD 50 will be charged for the academic tran-script, although a similar amount will be charged in futurebefore the start of the course (by means of an automatedHuman...
- 5
- 444
- 0
Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc
... follows: AURKA.FW:GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW:TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTCATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCATCTTCACCTTT, POLR2B.FW:CCTGATCATAACCAGTCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCTGCTTACC.Melting ... 9:100http://www.translational-medicine.com/content/9/1/100Page 2 of 6RESEARCH Open AccessAurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiationMarco Lo Iacono*, Valentina Monica, Silvia ... interpretation and draftedthe manuscript. MP and GVS participated in study design and coordination,data analysis and interpretation and drafted the manuscript. All authors read and approved the final manuscript.Competing...
- 6
- 300
- 0
Báo cáo sinh học: " Research Article Multiple Positive Solutions of Fourth-Order Impulsive Differential Equations with Integral Boundary Conditions and One-Dimensional p-Laplacian" ppt
... Corporation Boundary Value ProblemsVolume 2011, Article ID 654871, 26 pagesdoi:10.1155/2011/654871 Research Article Multiple Positive Solutions of Fourth-Order Impulsive Differential Equations with Integral Boundary ... this paper investigates theexistence of positive solutions for a class of fourth-order impulsive boundary value problems with integral boundary conditions and one-dimensional p-Laplacian. Moreover, ... of integral equations and their relation with boundary- value problems, we refer to the book of Corduneanu 22 and Agarwal and O’Regan 23.On the other hand, boundary- value problems with integral...
- 26
- 411
- 0
Báo cáo sinh học: " Research Article A Multifactor Extension of Linear Discriminant Analysis for Face Recognition under Varying Pose and Illumination" pdf
... multiple varying factors.In this paper, we separately address the advantages and disadvantages of multifactor analysis and discriminant anal-ysis and propose Multifactor Discriminant Analysis (MDA)by ... subspace algorithm[12] and a direct L DA algorithm [13], were proposed.3. Limitat i ons of Multifactor Analysis and Discriminant Analysis LDA and MPCA have different advantages and disadvan-tages, ... MDA can be thought of as an extension of LDA to multiple factor frameworks providingboth multifactor analysis and discriminant analysis. LDA and MPCA have different advantages and disadvantages,which...
- 11
- 312
- 0
Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt
... functional characterization of an insulin- binding protein in invertebrates. We haveidentified Imp-L2 as a secreted antagonist of IIS in Drosophila. Given the sequence homology of their Igdomains, ... genetic analyses of IIS in Drosophila and Caenorhabditis elegans have notrevealed a functional insulin- binding protein so far.Here, we report the identification of the secreted protein Imp-L2 as a ... to search for negative regulators of IIS in Drosophila. Our approach led tothe identification of Imp-L2 as a functional insulin- binding protein and antagonist of IIS.Imp-L2 encodes a secreted...
- 11
- 345
- 0
Báo cáo y học: " Is eosinopenia a reliable marker of sepsis" pps
... only for thediagnosis of infection but also as a marker of severity of organdysfunction in sepsis [4].Authors’ responseKhalid Abidi, Ibtissam Khoudri, Jihane Belayachi, Naoufel Madani, Amine ... Zekraoui A, ZeggwaghAA, Abouqal R: Eosinopenia is a reliable marker of sepsis onadmission to medical intensive care units. Crit Care 2008,12:R59.2. Gil H, Magy N, Mauny F, Dupond JL: Value of ... associationbetween eosinopenia and bacteremia [3].In conclusion, eosinopenia was not a reliable marker of infection. Other analytical parameters, such as C-reactiveprotein, have demonstrated to be...
- 2
- 232
- 0
Báo cáo y học: " Is there a protective effect of normal to high intellectual function on mental health in children with chronic illness" docx
... identification of risk and protective factors is important to improve treat-ment and preventive efforts. Intellectual function (IQ) is a factor that is known to haveaconsiderableeffectonachild’smentalhealth.First ... Hysing2†AbstractBackground: High intellectual function is considered as a protective factor for children s mental health. Fewstudies have investigated the effect of intellectual function on ... mental health in children with chronic illness (CI).The aim of the present study was twofold: First, we asked if normal to high intellectual function (IQ) has a protective effect on mental health...
- 8
- 368
- 0
Báo cáo y học: "Ischemia as a possible effect of increased intraabdominal pressure on central nervous system cytokines, lactate and perfusion pressures" ppsx
... intra-abdominal pressure on central nervous system cytokines, lactate and perfusion pressuresAthanasios Marinis1*, Eriphili Argyra2, Pavlos Lykoudis1, Paraskevas Brestas1, Kassiani ... tocompensatory tachycardia, followed by an increase in CPP and SPP and a decrease of cytokines and lactate. Conclusions: IAH resulted in a decrease of CPP and SPP lower than 60 mmHg and an increase of ... reperfusion.The negative impact of IAH on the cardiovascular sys-tem (decreased preload, decreased contractility, increased afterload), airway pressure (increased PIP) and acid-base homeostasis (acute...
- 10
- 581
- 0
Báo cáo y học: "MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system" docx
... expression in such cases.Neuroanatomical annotationAnnotation of brain areas was made according to the atlasesavailable for the embryonic and adult zebrafish [63,64] and available anatomical literature ... Addi-tional data file 5), optic tectum as well as novel areas of the dorsal hindbrain (cerebellar granular layer, facial and vagallobes; Additional data file 5, and Tables D and I in Additionaldata ... J in Additional data file 28,) at 3 and/ or 5 days and/ or 6 weeks(young adult (&apos ;Y- Ad' in Additional data files 1-29)) and/ oradult zebrafish (adult (&apos ;A& apos; in Additional data...
- 16
- 400
- 0
Báo cáo sinh học: "Is gene therapy a good therapeutic approach for HIV-positive patients?" pot
... suicidegenes was made popular as a potential approach for treat-ing cancer. As an anti-HIV strategy this method was triedin vitro as proof-of-concept in a study that used a retrovi-rus to transduce ... sequences to a target RNA. It pairswith the target RNA forming a double-stranded RNAstructure that either blocks translation or becomes a target for degradation in the cell. Attractive targets for this ... conclusion, gene therapy is a very attractive method for treating HIV-positive patients. The approaches under-taken so far have yielded encouraging results from a safetyefficacy standpoint. Future efforts...
- 9
- 436
- 0
Từ khóa: báo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcbáo cáo sinh học phân tửBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP