Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
... colorectal cancer. Br J Surg 2001, 88:130 7-2 0.doi:10.1186/147 9-5 87 6-8 -8 3Cite this article as: Croner et al.: One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas. ... was performed after the original analysis. OSNAruns were repeated from discordant sample homoge-nates and afterwards RNA was isolated and subjectedtoqRT-PCRforCK19,CEA,andbeta-actin.Condi-tions ... Motoshita J, Sakane J, Makita K, Akai Y, Daito M, Otomo Y,Ono H, Mizunoe T, Takeuchi Y, Tominaga H, Koseki M: Combinationanalysis of a whole lymph node by one -step nucleic acid amplification and...
- 6
- 535
- 0
Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc
... Empirical Methods in Natural Language Pro-cessing, pages 192–199.Hwee Tou Ng and Jin Kiat Low. 2004. Chinese part-of-speech tagging: One-at -a- time or all-at-once? word-based or character-based? In ... Innovative ap-plications of artificial intelligence, AAAI’97/IAAI’97,pages 598–603. AAAI Press.Michael Collins and Terry Koo. 2005. Discrimina-tive reranking for natural language parsing. ... Chineseparser augmented by transformation-based learning.ACM Transactions on Asian Language InformationProcessing, 3:159–168, June.Jianfeng Gao, Andi Wu, Cheng-Ning Huang, Hong qiaoLi, Xinsong...
- 10
- 476
- 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc
... using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2(5¢-ATACAATTAATTGACATCAGCAGACAGCAAATGCACTTGATATACGCAGCTCGACTACGTCGTAAGGCCG-3¢ and 5¢ -ATCTTTCAAATAGAGCCTGG-3¢). ... Z variantswere amplified from pUMZ-WT and pUMZ-K3 5A [7]using primers 5¢-TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTTATTTCGGCGCCTGAGCAT-3¢, and inserted into theSalI–BamHI ... cultivated yeast cells, and the codingregion of the binding candidates was amplified by PCR usingprimers 5¢-AAATATAAAACGCTAGCGTCGACATGGCGC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3 ¢. Thefinal ratio of target...
- 9
- 356
- 0
báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc
... operate and sustain the new HRIS. A Local Area Network (LAN) was installed at the UNMCand staff received training about the administration andmaintenance of the upgraded ICT system.Developing ... database becomes increas-ingly refined, accurate, and complete. Informationgleaned from the UNMC HRIS can be fed back in to theinformation systems at the central MOH for planningand administration ... 2:22 7-2 35.12. Gladwin J, Dixon RA, Wilson TD: Rejection of an innovation: healthinformation management training materials in east Africa. Health Policyand Planning 2002, 17:35 4-3 61.13. Gladwin...
- 10
- 535
- 0
báo cáo hóa học: " One-year health-related quality of life outcomes in weight loss trial participants: comparison of three measures" ppt
... findings and those from the vanNunen et al meta-analysis could be partially due to differ-ences in statistical methods. That is, the unit of analysis in a meta-analysis is the study, whereas ... well as acrossdiseases. Disease-specific measures contain items of par-ticular relevance to patients with the disease, and as such,have inherent face validity and salience. Additionally, dis-ease-specific ... disease-specific measures of HRQOL eachhave their advantages and disadvantages. Generic meas-ures are applicable to any population and scores may becompared to general population norms as well...
- 10
- 407
- 0
báo cáo hóa học:" Birth weight and characteristics of endothelial and smooth muscle cell cultures from human umbilical cord vessels" docx
... binding andinternalization of Ac-LDL was determined by incubatingcells grown on circular coverslips with culture media con-taining 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbo-cyanine ... in adult life. The molecular and cellular analysis of umbilical cord artery and vein mayprovide information about the early vascular characteristics of an individual. We have assessedseveral ... projec-tion area calculated in a pilot study (1,300 ± 250 μm2).Statistical analyses were performed using SPSS 13.0 (SPSSInc, Chicago, Illinois, USA) and GraphPad Statmate 2.0(GraphPad Software, La...
- 10
- 431
- 0
báo cáo hóa học:" Static platelet adhesion, flow cytometry and serum TXB2 levels for monitoring platelet inhibiting treatment with ASA and clopidogrel in coronary artery disease: a randomised cross-over study" potx
... Residual arachidonic acid- induced platelet acti-vation via an adenosine diphosphate-dependent but cycloox-ygenase- 1- and cyclooxygenase-2-independent pathway: a 700-patient study of aspirin resistance. ... Chemical EIA Analysis Tools [http://www.caymanchem.com/analysis/eia]34. Bryman A, Cramer D: Aggregating variables Exploratory factoranalysis. In Quantitative Data Analysis with SPSS Release 8 for ... 5'-diphosphate(ADP), adrenaline, lysophosphatidic acid (LPA) and ris-tocetin. Collagen, fibrinogen, ADP and adrenaline arephysiological agents that are well-known for their interac-tions with platelets....
- 14
- 521
- 0
báo cáo hóa học:" Identifying alemtuzumab as an anti-myeloid cell antiangiogenic therapy for the treatment of ovarian cancer" pdf
... Pharmingen) and anti-VE-Cadherin-PE (eBio-science), or Annexin-FITC and 7-Amino Actinomycin D(7-AAD BD Pharmingen) and analyzed by FACS. Onceagain to assess cellular viability an aliquot of ... streptavi-din-PE conjugate (BD Pharmingen). After biotinylationwas confirmed, streptavidin-saporin (Advances TargetingSystems, San Diego, CA) was incubated with biotinlabeled anti-CD52 antibodies ... (InvitrogenCarlsbad, CA) and quantitative PCR was performed using2 ng of total cDNA and SYBRgreen (Applied Biosystem;CD52, 5'primer CTTCCTCCTACTCACCATCAGC,3'primer CCACGAAGAAAAGGAAAATGC).HistologyImmunofluorescence...
- 14
- 728
- 0
báo cáo hóa học:" Hypoglycemic and beta cell protective effects of andrographolide analogue for diabetes treatment" pot
... mechanismsof action of this promising new anti-diabetic agent arewarranted.Abbreviations A. paniculata: Andrographis paniculata; Andro: androgra-pholide; AL-1: andrographolide-lipoic acid ... Poly-clone anti-GLUT4 antibody was purchased from Chemi-con International Inc. (Temecula, CA, USA). Polycloneanti-insulin antibody, ployclone anti-β-actin antibodyand HRP-conjugated goat anti-rabbit ... NF-κB activation stimulated by IL-1β and IFN-γ in RIN-m cellsFigure 7AL-1 inhibited NF-κB activation stimulated by IL-1β and IFN-γ in RIN-m cells. RIN-m cells were co-transfected by pNF-κB-luc and...
- 13
- 591
- 0
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
... Thecoding exon of GJB6 was amplified with the primers F(5’ TTG-GCT-TCA-GTC-TGT-AAT-ATC-ACC-3’)andR(5’ TCA-TTT-ACA- AAC-TCT- TCA-GGC -TAC -AG-3’ ). All t he PCR products were purified on Qia-quickspin ... analysisThe coding exon (exon 2) and flanking intronic regions ofGJB2 gene were amplified by PCR with the primers F(5’ TTG-GTG-TTT-GCT-CAG-GAA-GA-3’)andR(5’GGC-CTA-CAG-GGG-TTT-CAA-AT-3’ ) in ... Moreno-Pelayo MA, Del Castillo FJ, Brownstein Z, Marlin S,Adina Q, Cockburn DJ, Pandya A, Siemering KR, Chamberlin GP, Ballana E,Wuyts W, Maciel-Guerra AT, Alvarez A, Villamar M, Shohat M, Abeliovich...
- 7
- 695
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015