princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009
princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009
... Borneman, Jared Lindahl, Andrew Manseld, Andrea Neuhoff, Albert Silva, and Kristy Slominski—hammered away at the rst draft of the manuscript, especially the rst chapter. Their feedback was ... own and that of others) and how it acquires meaning as it arises in the body and through interaction with others. A more dynamic model of how we articulate our own experience and that of others ... set apart and the way they respond to them.• Things are always set apart relative to other things in a class. Set-ting something apart in this way marks it as special; we can refer to this...
- 229
- 1,453
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R ... CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 ... MR-1R was used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the left and right of the agarose gels. (B) Visualization and separation of high...
- 11
- 731
- 0
A further contribution to the study of the mortuary customs of the North American Indians docx
... brought and placed around the feet and legs of the horse, and gradually laid up to its sides, and at last over the back and head of the unsuspecting animal, and last of all over the head and even the ... Kagamale, the island in question, as the last resting-place of a great chief, knownas Karkhayahouchak. Last year the captain was in the neighborhood of Kagamale in quest of sea-otter and other ... Immediately upon the death of a member of the household, the relatives begin a peculiar wailing, and the immediate members of the family take off their customary apparel and clothethemselves in rags...
- 108
- 604
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated ... 07974. Barbara Brunson* AT&T Bell Laboratories and Department of Linguistics University of Toronto Toronto, Ontario, Canada M5S 1A1 . Abstract We present a model of morphological processing...
- 8
- 522
- 0
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt
... Italian), pastarant (pasta + restaurant) and peatza (pizza + eat). These three suggestions areamusing and have a nice ring to them. As a matter of fact, it turns out that the name Eatalian is actuallyused ... eating), pizza and pasta(which are found AtLocation restaurant) to generatean appropriate name. The three “palatable” neolo-gisms generated are eatalian (from the combination of eat and Italian), ... there is only one com-putational study in the literature that can be applied to the automatization of name generation. Stock and Strapparava (2006) introduce an acronym ironic re-analyzer and...
- 9
- 518
- 0
jesus our priest a christian approach to the priesthood of christ apr 2010
... blessed and brokeit, and gave it to them, and said: “Take, this is my body.” And he took a cup, and when he had given thanks he gave it to them, and they alldrank of it. And he said to them, ... not only the Messiah and the Son of God but also the Son of Man who will be seated at the righthand of God and will come ‘with the clouds of heaven’ at the climax of history to gather in the elect ... the loaves and fishes with language that points ahead to the priestly action of Jesus at the Last Supper. Mark writes of Jesusassuming a posture of prayer and seeking the blessing of God: ‘Takingthe...
- 322
- 436
- 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc
... delay and approximately linear-phase frequency response in the passband and the transition band and (ii) Design of synthesis prototypefilter such that the filter bank pairs distortion function approximates ... in the passband but also in the transitionband. The mean value of the group delay ranges below that of linear-phase filters of the same length. The observed overallsignal delay lies within the ... delayboth in the pass and in the transition band and (ii)meeting tight magnitude frequency response constraints for the stopband. The requirements concerning the stopbandattenuation can vary...
- 13
- 623
- 0
Báo cáo hóa học: " Research Article A Variational Approach to the Modeling of MIMO Systems" docx
... Pefor a given SNR, we study the determination of the theoreticalvalue of the optimal number of antennas. This theoreticalanalysis, which uses a statistical approach, allows to predict the number ... H∗ and g ∈ H the scalarf | g. The ket and bra notations satisfy the usual prop-erties of the Hilbert space including linearity and normal-ization; they are very useful in the study of scattering ... standardmethods of scattering theory can be used to study MIMOchannel. Here we exhibit rapidly the par allel between the channel equation of radio propagation and the so-calledBorn series of...
- 10
- 548
- 0
Từ khóa: a beginners guide to the study of religion ebooka beginners guide to the study of religion herlinga new approach to the problem of human interrelationswho shall survive a new approach to the problem of human interrelationssheep breeding in colonial canterbury new zealand a practical response to the challenges of disease and economic change 1850 1914a mutagenesis approach for the study of the structure function relationship of human immunodeficBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ