comparative phototoxicity of nanoparticulate and bulk zno to a free-living
comparative phototoxicity of nanoparticulate and bulk zno to a free-living
... Comparative phototoxicity of nanoparticulate and bulk ZnO to a free-living nematode Caenorhabditis elegans: The importance of illumination mode and primary particle sizeH. Ma a ,*,1, ... (abs.)Nano ZnO bulk ZnO Total surface area (m /l)2Total surface area (m /l)2ABFig. 6. Toxicity of nano -ZnO and bulk- ZnO to C. elegans (A) and methylene blue degradation (B) by the two materials ... paper demonstrates that phototoxicity of nano -ZnO and bulk- ZnO was dramatically enhanced under natural sunlight illu-mination as compared to artificial laboratory light illumination.This phototoxicity...
- 8
- 342
- 0
How do China and Brazil deal with water pollution challenges? A comparative perspective of two emerging countries’ approach to water pollution problems docx
... Europeans arrived in most of what today is known as Brazil, that land was like a gigantic Eden with clean natural resources and a balanced harmony between men and nature. Since the discovery of ... unregulated water and sewerage runoff (Osava, 2007). As Rio de Janeiro metropolitan area has grown to the west towards the Guandú basin, the main cause of water pollution is the untreated runoff of ... promotion of water sanitation plans. The National Water Supply and Sanitation Plan (Planasa) was institutionalised in 1971 during the military regime to guarantee financial resources transfers to Sanitation...
- 36
- 481
- 0
Application of Hydrothermal Reaction to Biodegradability Improvement of Refractory Pollutants: Structural Conversion of Di- and Trichloroacetic Acid to Biodegradable Products
... and formic acid were used as standard materials for qualitative and quantitative analysis of products obtained from CAAs. 2.2 Batch reactor apparatus Reaction was carried out using a batch ... and half-life time of CAAs in the field and laboratory study. Initial water quality indexes of DCAA and TCAA did not change in ambient water. Since the deviation of water quality indexes was ... case of TCAA, the biodegradability change was similar to that of DCAA. It can be explained by the fact that the structural conversion from DCAA and TCAA to biodegradable products occurred at...
- 8
- 643
- 0
Sensibility study of flooding and drying issues to the operating conditions in PEM fuel cells
... order to achieve high performances, water management in PEMFCs is one of the main critical issues to address: lack of water in the membrane can lead to an important increase of membrane resistance ... resistance and thus to a decrease of the cell potential, while an excess of liquid water in the electrodes can reduce gas transport to the catalyst layers and, again, decrease the cell voltage. The lack ... Hydro-Québec, Natural Resources Canada and the Natural Sciences and Engineering Research Council of Canada. E-mail address: Florent.Breque@mdacorporation.com Julien Ramousse received the B.Sc. and...
- 20
- 571
- 0
A contrastive analysis of grammatical and semantic features of words and idioms related to hearing in english and vietnamese
... MINISTRY OF EDUCATION AND TRAINING UNIVERSITY OF DANANG *** LE XUAN THANH GIANG A CONTRASTIVE ANALYSIS OF GRAMMATICAL AND SEMANTIC FEATURES OF WORDS AND IDIOMS RELATED TO “HEARING” ... English and Vietnamese. For this reason, a contrastive analysis of grammatical and semantic features words and idioms related to hearing in English and Vietnamese seems to be a significant task, ... contrastive analysis of grammatical and semantic features of words and idioms related to “hearing” in English and Vietnamese. By this topic we hope that we can help the teachers, the learners and...
- 13
- 1,297
- 3
Tài liệu LoopStar® 711 Leveraging a Full Suite of Ethernet and TDM Services to Cost-Effectively Utilize Fiber Networks doc
... revenue-generatingservices such as voice, and to add new packet-based services at the same time. The LoopStar 711is a fixed configuration, multi-service access platform offering cost-effective and easy -to- manageEthernet ... servicesthat require this transport. Usually deployed at the customer premise, this product can create a resilient infrastructure ideally suited for a variety of applications.Applications• Ethernet anywhere—extending ... cost-effective and easy -to- manageEthernet and TDM-based services that allow for the full utilization of fiber networks.The LoopStar 711 offers the complete suite of LoopStar 700 software, AC or DC power...
- 4
- 405
- 0
Tài liệu Applications of Robotics and Artificial Intelligence to Reduce Risk and Improve Effectiveness pdf
... quick-change hand and the dexterous hand. The robot would be able to charge a quick-change hand by itself, attaching the means of transmitting power as well as the physical hand to the arm. Although ... such as retrieval of disabled equipment; sampling and handling nuclear, biological, and chemically active materials (NBC); and limited decontamination. • Airborne Surveillance Robot. A semiautonomous ... in an adaptive manner. The status of the "dumb, deaf, and blind" robot is being raised to that approaching an "intelligent" automaton. This upgraded system can automatically...
- 276
- 593
- 0
Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt
... membrane of Gram-negative bacteria. It activates monocytes and macrophages to produce cytokines such as tumor necrosis factor- a and interleukins IL-1b and IL-6. These cytokines appear to be ... that phorbol ester and TNF -a induced ICAM-1 expression via activation of the JNK pathway and activator protein-1 [45], the pres-ent research suggests that the JNK pathway also plays a significant ... dehydro-genase (GAPDH) was used as an internal control and wasdetected using the following primers: sense, 5¢-TGATGACATCAAGAAGGTGGTGAAG-3¢; antisense, 5¢-TCCTTGGAGGCCATGTGGGCCAT-3¢. Cycling parameters...
- 11
- 519
- 0
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx
... Dublin,Ireland). To generate the pEP7–HFE-N11 0A HA vectorwe used the following primer set: sense, ATGGAAAATCACGCCCACAGCAAGGAG; antisense, CTCCTTGTCGTGGGCGTGATTTTCCAT. To generate the pEP7–HFE-N13 0A HA ... NN110/130AA mutant was made by introducing the N13 0A muta-tion into the pEP7–HFE-N11 0A HA plasmid. The HFENN130/234AA mutant was made by introducing theN23 4A mutation into the pEP7–HFE-N13 0A HA plasmid.The ... and transfected, and immuno-fluorescence microscopy was performed essentially asdescribed [28]. Primary antibodies used were mouse mono-clonal anti-HA (Abcam), rabbit anti-BiP (Abcam) and anti-TfnR...
- 16
- 538
- 0
Báo cáo khoa học: Thermodynamic characterization of substrate and inhibitor binding to Trypanosoma brucei 6-phosphogluconate dehydrogenase pot
... mM aPyADP in the same buffer. A total of 25 injec-tions was made at 380 s intervals. Top panel: raw ITC data. Bottompanel: data after the subtraction of the control titration and peakintegration. ... Cervellati, Franco Dallocchio and Stefania HanauDipartimento di Biochimica e Biologia Molecolare, Universita`di Ferrara, ItalyDrugs designed to combat African trypanosomiasisare often based ... contributes to binding. For NADPH and aPyADP, the binding appears to be totally enthal-pic, and a negative entropy change is associated withcomplex formation. It is known that NADP and NADPH bind in a...
- 10
- 402
- 0
Từ khóa: recent contributions of glaciers and ice caps to sea level rise pdfrecent contributions of glaciers and ice caps to sea level risea comparative study of british and vietnamese funeral ritualsthe nature of life and death according to biblehistory of biotechnology and its relevance to societythe nature of science and its relationship to technology society and the environmentNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM