Báo cáo khoa học: Plasmoredoxin, a novel redox-active protein unique for malarial parasites doc

... PRIORITY PAPER Plasmoredoxin, a novel redox-active protein unique for malarial parasites Katja Becker1, Stefan M. Kanzok2, Rimma Iozef1, Marina Fischer1, R. Heiner Schirmer2and Stefan Rahlfs11Interdisciplinary ... malaria; Plasmodium falciparum;redox-metabolism; thioredoxin superfamily.The malarial parasite, Plasmodium falciparum is respon-sible for more than 2 million deaths per year and novel antiparasitic ... structural and functional characteristics. In the mal-arial parasite, Plasmodium falciparum, a functional thio-redoxin and glutathione system have been demonstratedand are considered to be attractive...

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... antisense AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic presentation...

Báo cáo khoa học: "Compiling a Lexicon of Cooking Actions for Animation Generation" doc

... GenerationKiyoaki Shirai Hiroshi OokawaJapan Advanced Institute of Science and Technology1-1, Asahidai, Nomi, 923-1292, Ishikawa, Japan{kshirai,h-ookawa}@jaist.ac.jpAbstractThis paper describes a system ... e t al., 2003). Especially, severalresearchers have proposed animation generationsystems in the cooking domain. Karlin, for exam-ple, developed SEAFACT (Semantic Analysis For the Animation ... detail. Especially, we will not prepareobject data for many different kinds of ingredients. For example, suppose that the system has objectdata for a mackerel, but not for a sardine. Whena...

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was amplified with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. ... African trypanosomeTrypanosoma brucei is the protozoon that causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large parts of sub-SaharanAfrica. ... truncated fragments of TbPDE1were also amplified using the same protocol and pET-PDE1as template. PDE1(Arg189–Thr620) was amplified using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢...

Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

... show vast differences in p reference f or insect andmammalian Na+channels. Accordingly, they are dividedinto classical a- toxins that are highly active in mammalianbrain, a- toxins that are ... eneral de Asuntos del Personal Acad-emico (DGAPA), UNAM to L.D.P. The authors are grateful toDr Martin S. Williamson, IACR- Rothamsted, UK, for sharing thepara and tipE clone; C. Maertens and ... from poly (A) + mRNA u sing M-MLV reverse tran-scriptase. The cDNA was joined with the a daptor providedby the kit (5 ¢-gcugauggcgaugaaugaacacugcguuugCUGGCUUUGAUGAAA-3¢) using T4 DNA ligase. The...

Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx

... Katoh, Hideki Shibata and Masatoshi MakiDepartment of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, JapanAlix (also named AIP1) is an interacting ... reated by PCR-basedsite-directed mutagenesis using pmGFP–Brox as a template and complementary primers (5¢-CAA AAGGAC ACT GGG TCC TAC ATC TCC TAA G-3¢ and5¢-CTT AGG AGA TGT AGG ACC CAG TGT CCTTTT ... for generally aliphatic aminoacid, and X for any amino acid). Mammalian Alix and its yeast ortholog,Bro1, are known to associate with charged multivesicular body protein 4(CHMP4), a component...

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... messages in microblogs. Our system can be regarded as a sentiment-driven, music-based sum-marization framework as well as a novel audiovis-ual presentation of art. MemeTube is designed as a ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... In recent years, a number of studies have inves-tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of theme...

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... text spans; for example, because, since, and for this reason are different markers for causal relations. Discourse markers are a syntactically quite heterogeneous group of words, many ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they signal a concessive relationship ... that a dedicated discourse marker lexicon holding this kind of information can serve as a valuable resource for natural language pro- cessing. Our efforts in constructing that lexicon are...

Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx

... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the semantic annotations associated ... information. Hence, we will show how to annotate a syntax tree so that various interpretations can be characterized differently. Semantic Tagging A popular linguistic approach to annotate a ... from a semantic representation. In general, a particular interpretation of a sentence can be represented by an annotated syntax tree (AST), which is a syntax tree annotated with fea- ture...

Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx

... length-based and integrates a shal-low content analysis. It begins by individuating a paragraph in the target text which is a first candi-date as target paragraph, and which we call"pivot". ... corpora are available, also thetranslation equivalents of the collocation contextare displayed, thus allowing the user to see how a given collocation was translated in different lan-guages, and ... two kinds of tests on the paragraphsin this span: a test of paragraph content, and a testof paragraphs relative size matching. The first testcompares the paragraphs' numbering (if present).The...

Xem thêm