Báo cáo khoa học: Natural-abundance isotope ratio mass spectrometry as a means of evaluating carbon redistribution during glucose–citrate cofermentation by Lactococcus lactis potx

... Natural-abundance isotope ratio mass spectrometry as a means of evaluating carbon redistribution during glucose–citrate cofermentation by Lactococcus lactis Mohamed Mahmoud, Emmanuel Gentil and ... mass spectrometry; lactic acid bacteria; m etabolic regulation; pyruvate. A r ange of simple sug ars can be c atabolized anaerobically by Lactoc occus lactis and other lactic acid bacteria (LAB) ... than deleted, a- acetolactatedecarboxylase activity because strains characterized as lacking a- acetolactate decarboxylase [22] do not show a similar large D(d13Cdiacetyl–d13Cacetoin) [40]....

Tài liệu Báo cáo khóa học: Determination by electrospray mass spectrometry and 1H-NMR spectroscopy of primary structures of variously fucosylated neutral oligosaccharides based on the iso-lacto-N-octaose core doc

... 1B) are consistent with an octasaccharide of compo-sition Hex5HexNAc3. The approximate relative proportions of partially methylated alditol acetates (PMAAs) frommethylation analysis (Table ... Linkage and monosaccharide composition assignment from methylation analysis of milk oligosaccharides. PMAA, partially methylatedalditol acetate. Molar ratios are relative to 1,5-di-O-acetyl-2,3,4,6-tetra-O-methylgalactitol. ... typically at a concentration of 5–10 pmolÆlL)1,ofwhich5lL was loop-injected. Solvent(acetonitrile/1 mMammonium bicarbonate, 1 : 1, v/v) wasdelivered by a Harvard syringe pump (Harvard Apparatus,Holliston,...

Tài liệu Báo cáo khoa học: Bacterial-induced hepoxilin A3 secretion as a pro-inﬂammatory mediator pptx

... recruits anADP-ribosylation factor 6 guanine nucleotide exchangefactor (such as ARNO) to the apical plasma mem-brane. ARNO facilitates ADP-ribosylation factor 6activation at the apical membrane, ... theparticular case of HXA3, its stimulated production andrelease from the apical surface of infected intestinalepithelial cells provides an unprecedented pathway of regulated actions by a chemoattractant ... MINIREVIEWBacterial-induced hepoxilin A 3secretion as a pro-inﬂammatory mediatorBeth A. McCormickDepartment of Pediatric Gastroenterology, Massachusetts General Hospital, and Department of Microbiology...

Tài liệu Báo cáo khoa học: "Phrase-Based Statistical Machine Translation as a Traveling Salesman Problem" docx

... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 333–341,Suntec, Singapore, 2-7 August 2009.c2009 ACL and AFNLPPhrase-Based Statistical Machine Translation as ... we willpropose an alternative. This alternative is based onthe observation that phrase-based decoding can bevery naturally cast as a Traveling Salesman Prob-lem (TSP), one of the best studied ... called biphrases, as building blocks fortranslations, and score alternative candidate trans-lations for the same source sentence based on a log-linear model of the conditional probability of target...

Tài liệu Báo cáo khoa học: "Learning to Compose Effective Strategies from a Library of Dialogue Components" doc

... evaluationmeasure separately (by only using the rewards givenfor that particular measure), and a policy based on a combination (sum) of the rewards for all evalu-ation measures. We found that the learned ... effectiveness of a strategy depends onmany different factors, such as classiﬁcation/ASRperformance, the dialogue domain and task, and,perhaps most importantly, personality characteris-tics and knowledge ... phenomena like ambiguity and negation. A basefeature set was generated automatically, but quite a lot of features were manually tuned or added tocope with certain common dialogue situations....

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

... germ-cell development and germ-cell malignancy.Nature 460, 909–913.89 Hong H, Takahashi K, Ichisaka T, Aoi T, KanagawaO, Nakagawa M, Okita K & Yamanaka S (2009)Suppression of induced pluripotent ... hematopoietic com-partment using a CD34+hESC-derived starting popu-lation has been considered as a potential AIDStherapy, and as a way to alleviate secondary effectsproduced by anti-retroviral drugs ... a principal goal of the currentclinical research on hESCs. Recently, regression of metastatic melanoma tumors was achieved by trans-plantation of adaptive T cells speciﬁc for tumor anti-gens;...

Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx

... the plasma mem-brane early after receptor ligation whereas the celldeath regulators FAS-associated via death domain(FADD) and caspase 8 are recruited to a pro-apopto-tic complex that forms ... NEMO adaptorbridges the nuclear factor-kappaB and interferonregulatory factor signaling pathways. Nat Immunol 8,592–600.73 Ashida H, Kim M, Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C ... of caspases increases thesensitivity of L929 cells to necrosis mediated by tumornecrosis factor. J Exp Med 187, 1477–1485.62 Sasazuki T, Okazaki T, Tada K, Sakon-Komazawa S,Katano M, Tanaka...

Báo cáo khoa học: An antimicrobial peptide tachyplesin acts as a secondary secretagogue and ampliﬁes lipopolysaccharide-induced hemocyte exocytosis potx

... horse-shoe crab antimicrobial peptides. J Biol Chem 276,27166–27170.26 Kawabata S, Nagayama R, Hirata M, Shigenaga T,Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T& Iwanaga S (1996) Tachycitin, ... was ﬁrst identi-ﬁed as a stimulator that led to the release of histaminefrom rat mast cells [33]. Mastoparan forms an amphi-philic a- helix, and its carboxyl terminus is amidated.Mastoparan ... lipid A analogues and acidic phospholipids. Eur J Biochem176, 89–94.21 Nakamura T, Furunaka H, Miyata T, Tokunaga F,Muta T & Iwanaga S (1988) Tachyplesin, a class of antimicrobial peptide...

Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

... physicianpaternalism into the surrogate decision-making equation isethically unacceptable. Most rational surrogates are unwillingto continue life support after a reasonable trial hasdemonstrated ... suspended animation; they arenot alive in the sense the we enjoy life but neither are theyable to die as long as nutrition, hydration, ventilation, andperfusion are assured. In many cases reanimation ... that there isno meaningful chance of reanimation [8].Some reasons why this occurs are as follows:1. Physicians tell surrogates that they can make any decisionthey want as an open-ended ideal....

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... human RPE65, RPE65c or GFP as a negativecontrol at a MOI of 100. The isomerohydrolase activityassay was carried out as described previously [17]. TheY. Takahashi et al. A novel isomerohydrolase ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653...

Xem thêm