Báo cáo khoa học: Unique proteasome subunit Xrpn10c is a speciﬁc receptor for the antiapoptotic ubiquitin-like protein Scythe docx

... receptor for the antiapoptotic ubiquitin-like protein Scythe Yuhsuke Kikukawa1, Ryosuke Minami1, Masumi Shimada1, Masami Kobayashi1, Keiji Tanaka2,Hideyoshi Yokosawa1and Hiroyuki Kawahara11 ... family proteins and proteasome sub-unit S 5a. Biochemistry 41, 1767–1777.25 Kawahara H, Kasahara M, Nishiyama A, Ohsumi K,Goto T, Kishimoto T, Saeki Y, Yokosawa H, ShimbaraN, Murata S, et al. ... Journal compilation ª 2005 FEBS the C-terminal half of Xrpn10c was necessary for Scythe binding (Fig. 4A, D). Remarkably, mutationalanalysis revealed that neither the UIM1 nor the UIM2domain is...

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... glyceroldehydratase-reactivating factor reactivates the inacti-vated hologlycerol dehydratase in a similar manner.Both dehydratase-reactivating factors exist as a 2b2heterotetramers [a, DdrA or GdrA ... Science andTechnology, Japan, and a Grant in Aid for NaturalSciences Research (to T. Toraya) from the Asahi GlassFoundation, Tokyo, Japan. We thank Y. Kurimoto for her assistance with manuscript ... biochemical evidence for this has beenobtained so far. A similar reactivating factor for ethanolamine ammonia lyase has been reported [26].It has also been reported that a protein named E2activates...

Báo cáo khoa học: Proteomic identiﬁcation of all plastid-speciﬁc ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

... 5¢-GGAATTCTAGATATCGTCGACAATTTGTGTTACTACCAAAATC-3¢;P2-4,5¢-GGAATTCGTCGACGCGTTAAAAAAGATAGCAGCATTGACAC-3¢;P3-1,5¢-ATGGGIAAYGARGTIGAYATHG-3¢; P3-2, 5¢-CTAGACCTATGTTTTTCTCCATCC-3¢; P4-1, 5¢-CCIAARAAYAARAAYAARGG-3¢; P4-2, 5¢-CAGATAGGAAGAGGGGCAAGGA-3¢;P4-3,5¢-GGAATTCTAGATATCGTCGACTTATCTTCAGAACTTGTTGC-3¢; ... 5¢-CGGGATCCGGTGGCGACGACTCCTGGAGCCC-3¢;PR,5¢-CGGGATCCCAACTGGTAATGGTAGCGACCGGC-3¢;P2-1, 5¢-ATGGAYATHGCIACIACICARGC-3¢;P2-2,5¢-TAGCAACTCATTCGTCACTGTC-3¢; P2-3, 5¢-GGAATTCTAGATATCGTCGACAATTTGTGTTACTACCAAAATC-3¢;P2-4,5¢-GGAATTCGTCGACGCGTTAAAAAAGATAGCAGCATTGACAC-3¢;P3-1,5¢-ATGGGIAAYGARGTIGAYATHG-3¢; ... 5¢-CAGATAGGAAGAGGGGCAAGGA-3¢;P4-3,5¢-GGAATTCTAGATATCGTCGACTTATCTTCAGAACTTGTTGC-3¢; P4-4, 5¢-GGAATTCGTCGACGCGTTTTTCAACAAATCATCATAT A- 3¢;TAG1,5¢-GGAATTCTAGATATCGTCG-3¢;TAG2, 5¢-GGAATTCGTCGACGCG-3¢.Computer analysis A homology search was...

Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through speciﬁc protein interactions in the methionine synthase–methionine synthase reductase complex docx

... MSR enhances uptake of cobalamin by apo-MS, a role asso-ciated with the MSR-catalysed reduction of exogenous aquacob(III)alaminto cob(II)alamin [Yamada K, Gravel RA, TorayaT & Matthews RG(2006) ... experiments, an apparent Kdof  50 lm for NADPH for the MSR–NADPH com-plex [18]. These values are in reasonable agreementwith the apparent Km for NADPH measured in ourreactivation assays.Reactivation ... was isolated in the inactive form with the co-factor in the Co3+oxidation state (i.e. AqCbl). Activitymay arise from: (a) a small amount of enzyme present in the active methylcob(III)alamin...

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2 ⁄ PDIP46⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAGATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) ... SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ⁄ PDIP46(1) ⁄ SKAR (a) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1...

Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classiﬁcation" doc

... create a thesaurus. The thesaurus captures the relatedness among lexical elements that appearin source and target domains based on the contextsin which the lexical elements appear (their distribu-tional ... information between a feature (uni-gram or bigram) and a domain label. After selectingsalient features, the SCL algorithm is used to train a binary classiﬁer. SFA is the spectral feature align-ment ... technique of Pan et al. (2010). Both the LSAand FALSA techniques are based on latent semanticanalysis (Pan et al., 2010). For the Within-Domainbaseline, we train a binary classiﬁer using the la-beled...

Báo cáo khoa học: "Eﬃcient Optimization of an MDL-Inspired Objective Function for Unsupervised Part-of-Speech Tagging" docx

... the highestaverage accuracy. These were αt= 80, β = 0.05.We then ran MAP-EM again on the test data withthese hyperparameters and achieved a tagging ac-curacy of 87.4% (see Table 1). This ... Function for Unsupervised Part-of-Speech TaggingAshish Vaswani1Adam Pauls2David Chiang11Information Sciences InstituteUniversity of Southern California4676 Admiralty Way, Suite 1001Marina ... (Bos et al., 2009). This test set com-prises 21, 878 words annotated with POS tags and a dictionary for each word type. Since this is all the available data, we could not tune the hyperpa-rameters...

Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot

... two-level theory gives an explanation for the difference between aspectual information understood as a view on a situation and temporal features of a situation. The former can be gained after applying ... Holt and the three anonymous reviewers of this paper. This research was supported by a PhD-scholarship HSPII/AUFE awarded by the German Academic Exchange Service (DAAD). 1Besides the situation ... ed. ac.uk Abstract We apply Smith's theory of aspect (1991) to German - a language without any aspectual markers. In particular, we try to shed more light on the effects aspect can...

Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx

... which the primerswere 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CACGCAGCTCATTGTAGAAGG-3¢. Another primer pairused for SerpinA3 was ACTas5-ACTas3: 5¢-GAATCCACCAGCTACATCCA-3¢ and 5¢-GTGCCCTCCTCAAATACATCA-3¢.Western ... pcDNA3.1-GST-Nur77plasmid. pSilencer-shNur77 was prepared by overlappingstrategy with primers 5¢-gacGGATCCgcagtccagccatgctcctttcaagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATCGATccaaaaaacagtccagccatgctccttctcttg-3¢ ... 5¢-CTAATCTCTTCCTCCAAAAAGCACACAGA-3¢ for St-182 and St-93/-182, 5¢-AGAAATTATCATCTTTTCCAGTCCGAGA-3¢ for St-93 and St-93/-182, and 5¢-TGGTCTTGAACTCCTCGTGATCTGCCCA-3¢ for Lst-595.pcDNA3.1-Nur77 expression plasmid...

Báo cáo khoa học: Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells pdf

... Similarly b-actin cDNA was also amplifiedusing primers b-actin F (sense) (5¢-AGAAAATCTGGCACCACACC-3¢) and b-actin R (antisense) (5¢-TAG-CACAGCCTGGATAGCAA-3¢), and served as the inter-nal control. Melting-curve ... myeloblasto-sis virus-reverse transcriptase using an antisense DPP-III- specific primer AAS-2 (5¢-CTGAGCAGAGCATAGATGTAG-3¢; Fig. 1). A poly (A) tail was added to the 3¢-end of the purified cDNA with ... acetyl-l-leucyl-l-argininal, inhibitor of dipeptidyl aminopepti-dase III by bacteria. J Antibiot (Tokyo) 37, 680–681.7 Hazato T, Inagaki-Shimamura M, Katayama T & Ya-mamoto T (1982) Separation and characterization...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ