Báo cáo khoa học: Characterization of a b-N-acetylhexosaminidase and a b-N-acetylglucosaminidase/b-glucosidase from Cellulomonas fimi potx
Báo cáo khóa học: Characterization of Mesorhizobium huakuii lipid A containing both D-galacturonic acid and phosphate residues ppt
... 2004 Characterization of Mesorhizobium huakuiilipid A containing bothD-galacturonic acid and phosphate residuesAdam Choma1 and Pawel Sowinski21Department of General Microbiology, Maria Curie-Sklodowska ... by galacturonic acid.Long chain fatty acids with a hydroxyl group at the (x-1)position are present in lipids A of almost all bacteria from the Rhizobiaceae [18,25] and in lipids A of facultativeintracellular ... de-O-acylation of phosphorylated as well as of nonphospho-rylated lipid A was the same and equalled 717 Da (loss of both 294 and 423 mass units).The positive ion MALDI-TOF mass spectra of thelipid...
- 13
- 428
- 0
Tài liệu Báo cáo khoa học: Characterization of phycoviolobilin phycoerythrocyanin-a84-cysteinlyase-(isomerizing) from Mastigocladus laminosus pdf
... His6-PecA, His6-PecE, and His6-PecFHis-tagged PecA, E and F were purified separately by metalion chelating affinity chromatography on chelating seph-arose (fast flow; Amersham Pharmacia Biotech AB,according ... preparation of the subunits of PVB-PEC-lyase possessing His6-tags at the N terminus(to facilitate purification) and on their enzymatic char-acterization.MATERIALS AND METHODSOverexpression of ... Some of the linkers also carry bilin chromophores.Cyanobacterial and red-algal biliproteins are generallytrimers of an a/ b-heterodimer. a- andb-subunits are closelyrelated proteins, carrying...
- 9
- 468
- 0
Báo cáo khoa học: Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli pot
... thio-b-d-galacto-side and polyethyleneimine plates (Macherey & Nagel,Du¨ren, Germany) were from Sigma-Aldrich (St. Louis,MO, USA).3H-labelled acylated tRNA was prepared and stripped of amino acid according ... Ni-NTA agarose beads,unbound protein was removed (lane 2) and the beads washed(lanes 3, 4). SF was eluted with imidazole (lane 5) and precipitatedby dialysis against low salt ⁄ high magnesium ... (Fig. 7A) . This shows that the ribosomal A- site was saturated with unacylated tRNA [14] whenmaximal activation of SF occurred.Binding of tRNAPheto the A, P and E-sites of poly(U)programmed...
- 11
- 446
- 0
Báo cáo khoa học: Characterization of the cofactor-independent phosphoglycerate mutase from Leishmania mexicana mexicana docx
... obtained from RocheMolecular Biochemicals (rabbit muscle PYK and GAPDH and yeast PGK) and Sigma (rabbit muscle ENO and bovineheart LDH).Measuring PGAM activity in a LeishmanialysateThe mutase ... of 3PGA to 2PGA was coupled to NADH oxidation bylactate dehydrogenase (LDH) via enolase (ENO) and pyruvate kinase (PYK), and following the concomitantdecrease of absorbance at 340 nm. The assay ... staining. A majorband of approximately 60 kDa appeared at 10 and 25 mMimidazole fractions, and were pooled separatelyfor further assays.To determine optimal storage conditions of C-LmPGAM, its...
- 13
- 448
- 0
Báo cáo khoa học: Characterization of inhibitory mechanism and antifungal activity between group-1 and group-2 phytocystatins from taro (Colocasia esculenta) pdf
... Taiwan3 Department of Botany, Karnatak University, Dharwad, India4 Tainan District of Agricultural Improvement and Extension Station, Council of Agriculture, Tainan, TaiwanPhytocystatins are ... with a Bio-Rad protein assay kit (Bio-Rad, Hercules, CA, USA)using BSA as a standard.In-gel antipapain assayQualitative analysis of CeCPI protein was performedaccording to Michaud et al. [25] ... Shripathi Venkatagiri3, Ai-Hwa Yang4 and Kai-Wun Yeh11 Institute of Plant Biology, National Taiwan University, Taipei, Taiwan2 Department of Life Science, National Taiwan University, Taipei,...
- 10
- 383
- 1
Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the fish pathogen Francisella victoria ppt
... 2006)doi:10.1111/j.1742-4658.2006.05311.xLipopolysaccharide (LPS) and b-glucan from Francisella victoria, a fishpathogen and close relative of highly virulent mammal pathogen Francisellatularensis, have been analyzed using chemical and ... compo-nents: alanine, 3-aminobutyric acid (homoalanine orBABA), and a novel branched amino acid designatedAA. HMBC correlations allowed us to trace theBABA-acylated alanine, which was in turn ... p.p.m.) and one quaternary carbon at 79.0 p.p.m.Proton signals at 4.23 and 4.73 p.p.m. correlated with a quaternary carbon atom and carbonyl carbon atomsignals at 176.4 and 170.5 p.p.m. These data...
- 12
- 397
- 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc
... Characterization of the interaction between the plasmamembrane H+-ATPase of Arabidopsis thaliana and a novelinteractor (PPI1)Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... novel interactor of the C-ter-minus of Arabidopsis thaliana plasma membrane H+-ATPase (EC 3.6.3.6)(Morandini P, Valera M, Albumi C, Bonza MC, Giacometti S, Ravera G,Murgia I, Soave C & De ... from clones isolated previously[22] using the following primers: gatggatcccatATGGGTGTTGAAGTTGTA annealing around the start codon of thePpi1 ORF and gactcgagATTAGTCGACTTCTTACGCannealing just before...
- 8
- 629
- 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and downstream ... endo- and exo- peptidases are widespread innature and found in viruses, archaea, bacteria and euk-aryotes. The biological importance of peptidases areclearly indicated by the fact that 2% of all...
- 14
- 523
- 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Aiba Y, Nakamura K, Namba T, HirataM, Mazda O, Katsura Y & Narumiya S (1993)Thromboxane A2 receptor is highly expressed in mouseimmature thymocytes and mediates DNA fragmentation and apoptosis. ... pGL3e:Prm3AP)1*, pGL3b: Prm 3a AP)1*, pGL3e:Prm 3a AP)1*,pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b:Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1*.Mutation ... (TP) alpha and beta isoforms. Bio-chim Biophys Acta 1425, 543–559.25 Coyle AT, Miggin SM & Kinsella BT (2002) Characteri-zation of the 5¢ untranslated region of alpha and betaisoforms of...
- 18
- 509
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-amplified ... observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding ... Marchese, S., Angeli, S., Andolfo, A. , Scaloni, A. , Brandazza, A. ,Mazza, M., Picimbon, J F., Leal, W.S. & Pelosi, P. (2000) Solubleproteins from chemosensory organs of Eurycantha calcarata...
- 11
- 642
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ