Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx
Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx
... Okada K, Kamiya Y, Zhu X, Tanaka K,Nakagawa T, Kawamukai M & Matsuda H (1997)Analysis of the decaprenyl diphosphate synthase (dps)gene in fission yeast suggests a role of ubiquinone as anantioxidant. ... (5¢-to3¢)COQ1-BamHICCGGATCCCATGTTTCAAAGGTCTGGCCOQ1-SmaI GCCCCCGGGTTACTTTCTTCTTGTTAGTATACCOQ1-BamHI-TP45CCGGATCCATGTTTCAAAGGTCTGGCCOQ1-EcoRI CGAATTCTTACTTTCTTCTTGTCOQ1 -a CAGTGAATTCGAGCTCGGTACCCCOQ1-b ATACATACTGAATCATCATCTCCTTCGAG dps1 -a ... Escherichia coli and Saccharo-myces cerevisiae. J Bacteriol 179, 5992–5998.20 Okada K, Kainou T, Tanaka K, Nakagawa T, MatsudaH & Kawamukai M (1998) Molecular cloning and mutational analysis of...
- 16
- 315
- 0
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... Stability and structural analysis of alpha-amylase from the antarctic psychrophileAlteromonas haloplanctis A2 3. Eur J Biochem 222, 441–447.51 Almog O, Gonzalez A, Klein D, Greenblatt HM, BraunS & ... positions and gave a root mean square deviation of 0.84–1.21 A ˚(Table 2, Fig. 2). The structural resemblance withregard to root mean square deviation, fraction of com-mon Ca-atoms and the amino acid ... surfaces or differentdegrees of packing [42,44,47].Cold-adapted 1SH7 and mesophilic 1IC6 have a lar-ger solvent accessible surface area and a larger non-polar surface area than 1THM (Table...
- 14
- 597
- 0
Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx
... would initially require a 50,000 x 50,000 array of values (or a trian- gular array of about half this size). With our current hardware, the largest array we can comfortably handle is about 100 ... they approximated this data by just looking at the nearest NP on each side of a particular NP. Roark and Charniak (1998) built on that work by actu- ally using conjunction and appositive data ... members of each category, at least one judge marked on average about 31% of the nouns as correct. Using randomly-selected cate- gories and randomly-selected category mem- bers we achieved...
- 7
- 418
- 0
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx
... Russia, eastern Asia, Austra-lia, and New Zealand, and has the potential totransmit pathogens including viruses, rickettsia and protozoan parasites that cause important human and animal diseases ... A. Alim1 and Kozo Fujisaki2,31 Laboratory of Parasitic Diseases, National Institute of Animal Health, Ibaraki, Japan2 National Research Centre for Protozoan Diseases, Obihiro University of ... 34,799–808.45 Boldbaatar D, Sikalizyo Sikasunge C, Battsetseg B,Xuan X & Fujisaki K (2006) Molecular cloning and functional characterization of an aspartic protease from the hard tick Haemaphysalis longicornis....
- 14
- 432
- 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx
... werepurchased from Sigma.DNA manipulation and sequence analysisPlasmid DNA preparation, purification of DNA from agarose gel, and restriction enzyme analysis were performedby the standard methods ... 811–819.28. Lanzetta, P .A. , Alvarez, L.J., Reinach, P.S. & Candia, O .A. (1979)An improved assay for nanomole amounts of inorganic phos-phate. Anal. Biochem. 100, 95–97.29. Farahbakhsh, Z.T., Huang, ... succinyl-Phe-Leu-Phe-methoxynaphthylamide (Suc-FLF-MNA) and glutaryl-Ala-Ala-Phe-methoxynaphthylamide (Glt-AAF-MNA)were purchased from Bachem (Bubendorf, Switzerland).Insulin from bovine pancreas and dithiothreitol...
- 11
- 505
- 0
Báo cáo khoa học: Oxidase activity of a flavin-dependent thymidylate synthase pot
... the oxidase activity of FDTS from Thermatoga maritima to probe the binding and release features of the sub-strates and products during its synthase activity. Results from steady-state and single-turnover ... experimentally. Here, we report pre-steady-state and steady-state studies on the oxidaseactivity of FDTS from Thermotoga maritima, and elu-cidate the binding and release features of its synthase substrates ... analyze thedata from steady-state initial velocity measurements, kineticparameters were assessed from least-square nonlinearregression of the data to the appropriate rate equation withgrafit...
- 10
- 435
- 0
Báo cáo khoa học: Directed evolution of a histone acetyltransferase – enhancing thermostability, whilst maintaining catalytic activity and substrate specificity doc
... substrate specific-ity. P ⁄ CAF, p300 ⁄ CBP-associating factor, is a transcriptional coactivator with a variable N-terminal, a central HAT domain and a C-terminal bromodomain.Several stabilizing ... his-tone acetyltransferase domain of the human PCAFtranscriptional regulator bound to coenzyme A. EMBOJ 18, 3521–3532.35 Ahmad S, Gromiha MM, Fawareh H & Sarai A (2004)ASAView: solvent accessibility ... for a reaction progress curve as a measure of HAT activity.Fig. S4. The gene for P ⁄ CAF and its flanking regions.Table S1. Relative solvent accessibility of amino acids of the catalytic domain...
- 13
- 226
- 0
Báo cáo khoa học: Nuclear localization of human spermine oxidase isoforms – possible implications in drug response and disease etiology pptx
... primer pair 5¢-CAATCCTCGAGTATGCAAAGTTGTGAATCCAG-3¢ and 5¢-TAATAAGCTTTGGTCCCCTGCTGGAAGAGGTC-3¢ and each cDNA in pET15b as the template. PCR products wererestriction digested with XhoI and HindIII ... amount of available spermine inthe cell.Localization of SMO in H157 cellsWestern blot analysis and quantification of nuclear and cytoplasmic protein extracts indicated that allthree isoforms, ... SMO activityassays of SMO ⁄ PAOh1 and SMO5 overexpressingnuclear and cytoplasmic extracts corroborate thesedata, showing spermine oxidase activity and H2O2generation in both nuclear and...
- 12
- 395
- 0
Báo cáo khoa học: Bilayer localization of membrane-active peptides studied in biomimetic vesicles by visible and fluorescence spectroscopies pptx
... biomimeticmembranes.The emergence of bacterial strains resistant to conventionalantibiotics is a major cause of inefficient therapy and increased mortality from bacterial infection. The use of antimicrobial ... trans-membrane pore formation via a Ôbarrel-staveÕ organization [6], while a second model,denoted the Ôcarpet mechanismÕ, proposes accumulation of the amphipathic peptides at the membrane interface as ... acid analysis and analytical HPLC.Vesicle preparationAll lipid constituents were dissolved in chloroform/ethanol(1 : 1, v/v) and dried in vacuo to constant weight. Apart from vesicle preparations...
- 10
- 479
- 0
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
... Dissociation and reassociation was analysed by SDS ⁄ PAGE. Two micrograms of pro-tein were loaded on each lane and the gel was stained with silver.M, Bio-Rad11broad molecular mass standard (Bio-Rad ... December2004)doi:10.1111/j.1742-4658.2004.04524.xThe oxaloacetate decarboxylase Na+pumps OAD-1 and OAD-2 of Vibriocholerae are composed of a peripheral a- subunit associated with two integ-ral membrane-bound subunits (b and c). The a- subunit ... cytosolic fraction and themembrane fraction.Purification VcOadA-2, VcOadA-2-C, and VcOadG A- 2 and its derivatives by monomericavidin-Sepharose affinity chromatographyThe plasmids containing the...
- 10
- 333
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ