Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf
Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf
... 2709REVIEW ARTICLE Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy Beata A. WoluckaLaboratory of Mycobacterial Biochemistry, Institute ... galactan backbone. The arabinan consists of an inner linear region of Araf-(1 fi 5) -a- Araf and of branched non-reducing terminal Ara6 motifs: Arafb1fi 2Arafa1 fi 5 (A rafb1 fi 2Arafa1 fi 3)Arafa1 fi5Arafa1. ... present in arabi-nogalactan, and a simplified linear Ara4 motif: Ara-fb fi 2Arafa1 fi 5Arafa1 fi 5Arafa1. Some of thenon-reducing arabinofuranose termini are capped with short chains of a( 1 fi 2) d-mannose...
- 21
- 572
- 0
Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc
... proceduresMaterials and cell linesThe mAbs V.1 and V.5 ag ainst GPV, ALMA.12 againstGPIba, ALMA.16 against GPIX and RAM.1 againstGPIbb, were developed in our laboratory [19]. CHO celllines CHO-K1 and CHO-DUK ... [NaCl/Picontaining 0.2% (w/v) BSA and 1% (v/v) goat serum].CHO/GPIb–V–IX cells were incubated for 45 min at roomtemperature with the mAb V.1 in blocking solution, washedand incubated with a GaM–Cy5 ... molecular mass form during the 180 min of chase.On the o ther hand, an 80 kDa mature form progressively appearedand accumulated in the s upernatants at c hase times o f 6 0–1 20 min.Because a t...
- 7
- 363
- 0
Báo cáo khoa học: Biosynthesis of riboflavin in Archaea 6,7-Dimethyl-8-ribityllumazine synthase of Methanococcus jannaschii pdf
... 5¢-GGAGAAATTAACCATGGTATTGATGGTAAATCTTGG-3¢MJ-RibE-2 BamHI 5¢-TTCTTTGGAAGGGATCCAATTTCATAAAAATTT-3¢MJ-RibE-3 EcoRI 5¢-ACACAGAATTCATTAAAGAGGAGAAATTAACTATG-3¢BS-RibH-DN-G6 EcoRI, NcoI5¢-ATAATAGAAGAATTCATTAAAGAGGAGAAATTAACCATGGGAAATTTAGTTGGTACAG-3¢BS-RibH-2 ... NcoI5¢-ATAATAGAAGAATTCATTAAAGAGGAGAAATTAACCATGGGAAATTTAGTTGGTACAG-3¢BS-RibH-2 BamHI 5¢-TATTATGGATTCTTATTCGAAAGAACGGTTTAAG-3¢Fig. 1. Terminal reactions in the pathway of riboflavin biosynthesis. 1026 I. Haase ... a deaminase and a reductase involved in biosynthesis of ribo-flavin. J. Bacteriol. 136, 65 7–6 67.7. Hollander, I. & Brown, G.M. (1979) Biosynthesis of riboflavin:reductase and deaminase of...
- 8
- 300
- 0
Tài liệu Báo cáo khoa học: Biosynthesis of riboflavin Screening for an improved GTP cyclohydrolase II mutant pdf
... by the addition of the DNA sequence motif 5¢-GAATTCattaaagaggagaaattaact ATG AGA GGA TCT CACCAT CAC CAT CAC CAT GGG ATC GAT CAT-3¢ in front of the start codon. The modified ORF features anNde1 ... Constructs C and E (Table 1); in fact,preliminary data showed that various mutant protein sselected for their increa sed Vmaxvalue also showed anincrease in their Kmvalue.The increased Kmvalues ... four-fold increase in the Kmvalue with GTP asthe substrate. Using the analog 2-amino-5-formylamino-6-ribosylamino-4(3H)-pyrimidinone 5¢-triphosphate as the substrate, the mutant showed a rate enhancement...
- 11
- 487
- 0
Tài liệu Báo cáo khoa học: "ANALYSIS OF OONOUNCTIONS IN PAKSER" potx
... com[xm~t of the FIDO system (a Flexible Interface for Database Operations), which is a prototype allowing an end-user to interact in natural language (Italian) with a relational data base. The ... ANALYSIS OF OONOUNCTIONS IN A ~JLE-~ PAKSER leonardo L~smo and Pietro Torasso Dipartimento di Informatica - Universita' di Torino Via Valperga Caluso 37 - 10125 Torino (ITALY) ABSTRACT ... the Ministero della Babblica Istruzione of Italy, MPI 40% Intelligenza Artificiale. the conjunctions are handled by m~ans of a para- syntactic mechanis~ that enables the parser to analyze...
- 8
- 517
- 0
Báo cáo khoa học: Expression of cholinesterases in human kidney and its variation in renal cell carcinoma types pdf
... Biol Interact15 7–1 58, 3 7–4 1.53 Kamal MA, Nasim FH & Al-Jafari AA (1999) Humanerythrocyte acetylcholinesterase inhibition by cis-diamminediaquaplatinum (II): a novel kinetic approach.Cancer ... 30, 34 8– 349.51 Hamamoto Y, Niino K, Ishiyama H & Hosoya T(2004) Impact of pretreatment cholinesterase level onsurvival of inoperable intrahepatic or hepatic-hilarcarcinoma treated with ... (BW284c51),tetraisopropyl pyrophosphoramide (Iso-OMPA), Brij 96,antiproteinases, protein markers for sedimentation analysis(beef liver catalase and bovine intestine alkaline phospha-tase), phenyl–agarose,...
- 11
- 474
- 0
Báo cáo khoa học: "Role of Verbs in Document Analysis" pot
... what, and where. For ex- ample, in summarization, Barzilay and Elhadad (1997) and Lin and Hovy (1997) focus on multi- word noun phrases. For information extraction tasks, such as the DARPA-sponsored ... classes of Levin's EVCA as a basis for our next analysis. 3 Levin's seminal work is based on the time-honored observation that verbs which par- ticipate in similar syntactic alternations ... correlation, i.e. the presence of one class increases as the presence of the correlated verb class increases. A T value of 0 would show that the two variables' values are independent of each...
- 7
- 416
- 0
Báo cáo khoa học: Biosynthesis of riboflavin 6,7-Dimethyl-8-ribityllumazine synthase of Schizosaccharomyces pombe pot
... aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgcccgcggtaatcttcaag 3¢W27I AseI5¢ aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgcccgcattaatcttcaag 3¢W27S AsuII 5¢ aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgcccgttcgaatcttcaag ... mutations are underlined.Designation Endonuclease Sequence A- 1 5¢ ataatagaattcattaaagaggagaaattaactatgttcagtggtattaaaggccctaac 3¢ A- 2 5¢ tattatggatccttaatacaaagctttcaatcccatctc 3¢W27G SacII ... aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgcccgttcgaatcttcaag 3¢W27H SacI5¢ aaaggccctaacccttcagacttaaagggaccagagctccgcattcttattgtccatgcccgccataatcttcaag 3¢W27F SphI5¢ aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtgcatgcccgctttaatcttcaag...
- 8
- 343
- 0
Báo cáo khoa học: Biosynthesis of isoprenoids – studies on the mechanism of 2C-methyl-D-erythritol-4-phosphate synthase pdf
... target for the develop-ment of novel antimalarial agents, which are urgentlyneeded in light of the enormous death toll of malaria[23] and the rapid dissemination of variants with resis-tance ... 4-phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis. Proc Natl Acad SciUSA 95, 987 9–9 884.16 Kuzuyama T, Shimizu T, Takahashi S & Seto H (1998)Fosmidomycin, a specific ... coupling satellites expected in thespectrum of 1c are marked by arrows in Fig. 4B–D. In each case, the integrals of the satellite signals are in the range of 1% as compared to the central signal.Signals...
- 14
- 534
- 0
Báo cáo khoa học: Deletion of Phe508 in the first nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator increases its affinity for the heat shock cognate 70 chaperone docx
... determined from each set of dose–response data by global fitting of the association anddissociation phases of all binding curves in that dataset(biaeval). The dissociation constant (KD) for each ... proteins composed of an N-terminal ATPasedomain, a substrate-binding region, and a C-terminal15 kDa ‘lid’ regulating binding affinity for ‘client’ pro-teins. These chaperones bind short (approximatelyseven ... reference surface,analysed using biaevaluation software (biaeval; v. 3.2;GE Healthcare), and displayed in sigmaplot (v. 10; Systat,San Jose, CA, USA) as pmoles of interacting protein (e.g.NBD1)...
- 13
- 393
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM