Báo cáo khoa học: Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayﬁsh testis and evidence for its release into the seminal ﬂuid ppt

... works Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid Juraj Simunic, Daniel Soyez and Ne´dia KamechEquipe ... 2009)doi:10.1111/j.1742-4658.2009.07169.x In the present study, an isoform of angiotensin-converting enzyme wascharacterized from the testis of a decapod crustacean, the crayfish Asta-cus leptodactylus. Angiotensin-converting enzyme ... cDNA, obtained by3¢-to5¢ RACE of testis RNAs, codes for a predicted one-domain proteinsimilar to the mammalian germinal isoform of angiotensin-converting enzyme. All amino acid residues involved...

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC...

Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

... kept at 4 °C and used within 10 days.Quantification of alkaline phosphatase and aminopeptidase activitiesSpecific alkaline phosphatase (ALP) and N-aminopeptidase(APN) enzymatic activities of BBMV ... 0.2MGalNAcGalNAca1 fi 3GalSophora japonica (SJA) Galb1 fi 3GalNAc 0.2MGalGalb1 fi 3,4GlcNAcWistaria floribunda (WFL) a/ bGalNAc 0.2MGalNAcHelix pomatia (HPL) GalNAca1 fi 3GalNAc 0.2MGalNAcGalNAca1 ... results, these observations are evidence of a direct interaction between Cry1Ac and membrane-bound forms of alkaline phosphatase.As reported for other insect alkaline phosphatases [32],HvALP was...

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... mmEDTA at 37 °C and 50 °C and samples were collected after15, 30, 60, 90 and 120 min. At each time point, the samplewas incubated on ice for 5 min and remaining activitytoward Suc-AAPF-pNA was ... Tanaka K, Kawai M, TainakaK, Imada C, Okami Y & Inamori Y (1993) Cloning and sequence of an alkaline serine protease-encodinggene from the marine bacterium Alteromonas sp. strainO-7. Gene ... NorwaySerine endo- and exo- peptidases are widespread in nature and found in viruses, archaea, bacteria and euk-aryotes. The biological importance of peptidases areclearly indicated by the fact that...

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding site. The ligand binding activity of ASP3c was furtherinvestigated using displacement of ASA, a fatty acid ... CSP.EXPERIMENTAL PROCEDURESStrains and materialsEscherichia coli strain DH 5a was used for DNA subcloning and propagation of the recombinant plasmid. Pichiapastoris strain GS115 (his4) was used in the ... recombinant protein.Binding of ligands assessed by the intrinsictryptophan ﬂuorescence The recombinant protein appeared therefore quite amena-ble to ligand-binding studies, as it was chemically...

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... transcription of Aro80target genes [14]. Therefore, potentially, ARO10 and its associated genes may be responsible for the catabo-lism of aromatic and branched-chain amino acids, aswell as ... sequence,confirming that the N-terminal Met and Ala wereindeed absent. Although cleavage of the terminal Metwas not unexpected, the loss of the alanine residue wasinitially surprising. However, the literature ... alternative pathways are avail-able, it is unlikely to play any significant role in the catabolism of the branched-chain amino acids or of methionine.Identification and mutation of residues affectingsubstrate...

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

... NorwayHaemerythrin proteins comprise a family of O2-carrry-ing proteins mainly found in a few phyla of marine invertebrates. Members of this family differfrom haemoglobin and haemocyanin in that they ... as a template. The quality of the model was ﬁrst assessed usingprocheck [32,33]. The vast majority of residues (89.7%) fall into the most favoured regions of the Ramachandran plot,9.4% in the ... chemoreceptor was proposed to have a mem-brane-spanning domain, placing the C-terminallylocated Hr domain in the cytoplasm. The biologicalfunction of DcrH and its Hr-like domain is not fullyelucidated.To...

Báo cáo khoa học: Characterization of a high-afﬁnity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... binding of PA1b to a proteinaceous component of a particulate fraction of S. oryzae extracts. The binding was saturable and reversible, and the binding site exhibits a high afﬁnity for the native3741 ... tubes. The radioactivity wascounted on a gamma counter (Riastar, Packard Instrument,USA), and each point was the mean of triplicates. Bindingdata were analyzed using the RADLIG 4 software (BIO-SOFT, ... known as a seed albumin [5], it was named PA1b for pea albumin 1b.PA1b is the result of the post-translational cleavage of the albumin proprotein PA1, also releasing a second peptide(PA 1a) . PA1b...

Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase puriﬁed from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

... by ﬁtting data by a weighted linear regression using the software SigmaPlotÒ. AlabNA,L-alanine-b-naphthylamide; AlapNA, L-alanine-p-nitroanilide; ArgpNA, L-arginine-p-nitroanilide; MetbNA,L-methionine-b-naphthylamide; ... BmoAAX39866 Tni APN4AAK69605 SliAAF37559 Hpu APN2AAK58066 HviAAC36148 PinAAX39865 Tni APN3AAF01259 Pxy APN3Q11000 HviAAN75694 Har APN2AAF37560 Hpu APN3AAF99701 EpoAAD31183 Ldi APN1AAL83943 ... withthis, the partially EDTA-inactivated enzyme has the same Km and pH optimum as native aminopeptidase(not shown).Carbohydrate and lectin interactions with A. pisum APN The enzyme strongly interacts...

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... prevent the abnormal accumulation of intracellular acyl-CoA.We have isolated a thioesterase from Alcaligenesfaecalis ISH108 and demonstrated its application in chemoselective and racemization ... pH 7.2, containing 0.1 m NaCl. The reaction was started by the addition of 0.2 lg enzyme. The initial rate was determined by measuring the increase in A 346, the isobestic point of the p-nitrophenol ... 2387 Characterization of a novel long-chain acyl-CoAthioesterase from Alcaligenes faecalisPuja Shahi*†, Ish Kumar*‡, Ritu Sharma, Shefali Sanger and Ravinder S. JollyInstitute of Microbial...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật