Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt

... (5¢-gaaaggcatcccgaacgcat-3 ); Chip2upprimer (5¢-aaatgtcttgaccagccgtc-3 ) and Chip2dw primer(5¢-gaaacaaaggcctctcccag-3 ); Chip3up primer (5¢-gctttgcagt-cagaatggtc-3 ) and Chip3dw primer (5¢-ctgagcactgactac-gaaac-3 ). ... expressionanalysis. This approach identiﬁed the Promyelocytic Leukemia Zinc Finger (PLZF) gene as a putative gene target of CUX1. PLZF was originally identiﬁed as a t(11;1 7) reciprocal chromosomal translocation ... hB2MIC227dw, 5¢-tcaatgtcggatggatgaaa-3¢.AcknowledgementsWe thank Dr Peter G. Traber for the generous gift of the microarray data analysis that was originally per-formed at the Penn Microarray Facility...

Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf

... Committee of the University Hospital of Patras.Analysis of genomic DNA for GH and GHRmutationsGenomic DNA was isolated from peripheral blood leuko-cytes for the analysis of the GH-1 gene and was ampliﬁedusing ... Diaz2, Dimitris Kletsas3, Efthimia K. Basdra4,Theodore K. Alexandrides5, Zvi Zadik6, Stuart J. Frank7, Vassiliki Papathanassopoulou1,Nicholas G. Beratis1, Athanasios G. Papavassiliou2and ... using a Lipofectamine 2000 kit(Invitrogen) and were repeated at least three times. The amount of transfected DNA was kept constant by the addi-tion of appropriate amounts of the parental, empty...

Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

... insects. Annu Rev Entomol 51,1–24.7 Nagasawa H, Kataoka H, Isogai A, Tamura S, Suzuki A, Mizoguchi A, Fujiwara Y, Suzuki A, Takahashi SY& Ishizaki H (198 6) Amino acid sequence of a protho-racicotropic ... H, Nagasawa H, Kataoka H,Isogai A, Tamura S, Suzuki A, Fujino M & Kitada C(198 7) A monoclonal antibody against a synthetic frag-ment of bombyxin (4K-prothoracicotropic hormone)from the ... characterization andimmunohistochemistry. Mol Cell Endocrinol 51, 227–235.41 Nagata K, Maruyama K, Nagasawa H, Urushibata I,Isogai A, Ishizaki H & Suzuki A (199 2) Bombyxin-IIand its disulﬁde...

Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx

... GGAGCAAGAGGTTCAGCATCMLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAAMLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTGMLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTGHOXC13-ERE1 GCGTCTCCCTGTCCCTTTA CAGGTCTCCTGGGGTTCCHOXC13-ERE2 ... TTGCCGAGTATATTCCATTGC TCTGCTTTACCTCGCTGGATHOXC13-ERE3 TTTCAGGCCCTTTGTTTCTC CGCGGGTAGTAGAAGTGGAAHOXC13-ERE4 TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACCERa antisense CATGGTCATGGTCAG a ERb antisense ... (Bethyllaboratory), MLL3 (Abgent, San Diego, CA, USA), MLL4(Sigma), ERa (Santa Cruz Biotechnology, Santa Cruz, CA,USA), ERb (Santa Cruz), and b-actin (Sigma), and devel-oped using the alkaline...

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding speciﬁcity pdf

... of chain A is close to Asn77 of chain B, then Asn77 of chain A is close to Ala25 of chain B.Chain A Chain B Hydrogen bondsAla25 Asn77, Arg80 AlaO–ArgNH1AlaO–ArgND2Asn26 His35, Arg80, Asn39 AsnOD1–ArgNH1AsnOD1–HisNE2Ser28 ... be incontact when at least one atom of a residue of chain A is at a dis-tance shorter than 4.0 A ˚from an atom of a residue of chain B.When a hydrogen bond is formed, the two atoms are explicitlymentioned ... in the stimulation of angiogenesis, to inhibit intestinal diar-rhea, and to regulate ﬂuid volumes in other organs[23]. At the same time, erucamide is a contaminant of plastic materials, and is...

Báo cáo khoa học: 7,8-Diaminoperlargonic acid aminotransferase from Mycobacterium tuberculosis, a potential therapeutic target Characterization and inhibition studies pptx

... tuber-culosis DAPA AT by KAPA. (A) The activity was measured at var-ious AdoMet and KAPA concentrations. n 20 lM KAPA; h 50 lMKAPA; d 70 lM KAPA; s 100 lM KAPA; r 140 lM KAPA. (B) Re-plot of the ... 5¢-CGCGCGAATTCAGGAGGAATTTAAAATGCACCACCACCACCACCACGCTGCGGCGACTGGCG-3¢ contain-ing an EcoRI restriction site, a ribosome-binding site and a His6tag coding sequence, and 5¢-GCAAGCTTTCATGGCAGTGAGCCTACGAGCCG-3¢ ... biosynthesis, and in particular the transami-nation step catalyzed by DAPA AT, are valid targetsfor antibiotic directed against mycobacteria. Obvi-ously, mycobacteria could reverse the effect of...

Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt

... has a glutamine-asparagine pair at the positions defining ATP as a sub-strate instead of the lysine-aspartate consensus. Weshow that the purified catalytic domain of Rv0386 is active as an AC ... [14]. Here, the substrate-specifying lysine-aspar-tate pair is replaced by asparagine-aspartate and the catalytic asparagine is altered to histidine. Structuredetermination and mutagenesis experiments ... findings cannot possibly be recon-ciled with and discussed on the basis of the availablestructural data of canonical mammalian class IIIa andmycobacterial class IIIc catalytic domains [5,7,9,25]nor...

Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx

... the phosphorylation by phorbol 12-myristate 13-acetate acti-vated protein kinase C. J Biol Chem 279, 11444–11455.12 Ozaki T, Watanabe K-I, Nakagawa T, Miyazaki K,Takahashi M & Nakagawara A (200 3) ... commercial PKC-Pan (Promega,Madison, WI). PKC-Pan was puriﬁed from rat brain andconsists predominantly of the PKC isoforms a, b and c.Functional association of Ki-1 ⁄ 57 and PRMT1 D. O. Passos et al.3958 ... cerevisiae strain L40. A humanfetal brain cDNA library (Clontech, Palo Alto, CA) expres-sing GAL4 activation domain (AD) fusion proteins wascotransfected with each one of these three recombinantpBTM116...

Báo cáo khoa học: Snail associates with EGR-1 and SP-1 to upregulate transcriptional activation of p15INK4b doc

... 5¢-GGCATATGATGGAGATGATACTGA-3¢ (rev-erse). SP-1: 5¢-TAGGAGAGATTGGGAGAAATCATC-3¢(forward) and 5¢-AAGATACCAGAAGGTCGAGAGAGA-3¢ (reverse). GAPDH was included as internal controlto correct for equal RNA ... in Table S2. The coefﬁcient of var-iation of pRL activity of each sample was within 2.0–9.0%by statistical analysis of triplicate data (n = 3). Nonradioactive EMSA A DNA probe was biotinylated ... (con) as 1.0. (B) Real-time PCR forcomparison of the basal levels of the three genes, taking the amount of EGR-1 as 1.0. In (A) and (B), the results are the average of ﬁveexperiments with a C.V....

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

... CBP is a structural platform that is capable of binding severaldifferent families of transcriptional activators [30], andevidence indicates that the KIX domain has the abilityto simultaneously ... HRX,Htrx) are associated with a unique subset of acutelymphoblastic or myelogenous leukemias [1–4]. The product of the MLL1 gene is a large protein that func-tions as a transcriptional co-activator ... with the poor catalytic activity of the isolatedMLL1 SET domain. However, an analysis of crystalpacking forces suggests that the SET-I lobe may beconstrained in an unnatural conformation in the...

Xem thêm