Báo cáo khoa học: Sp3 transcription factor is crucial for transcriptional activation of the human NOX4 gene doc
Báo cáo khoa học: Sp3 transcription factor is crucial for transcriptional activation of the human NOX4 gene doc
... essential for transcriptional activation of the human NOX4 promoterFigure 1 shows the alignment of the 5¢-flanking and5¢-noncoding sequences of the human, rat and mouse NOX4 genes. Compared with the ... similaritybetween the rat and mouse sequences, the similarity of the human sequence was relatively low. Therefore, weisolated the promoter region of the human NOX4 gene and examined its transcriptional ... ubiquitous expression of NOX4 in human tissues. We report here the predominant role of the transcription factor specificity protein (Sp) 3 in the expressional regulation of the human NOX4 gene. ResultsGC-boxes...
- 9
- 362
- 0
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt
... tissues. Two types of KLK11 isoforms,isoform 1 and isoform 2, have been predicted from cDNA sequences. Iso-form 1 has been isolated from human hippocampus, whereas isoform 2 hasbeen isolated from ... antibody raised against KLK11 was the same sizeas that of the translational product by isoform 2mRNA (Fig. 4B). The product by isoform 1 mRNAwas smaller than the isoform 2 product. The multiplebands ... KLK11, isoform 2,despite the presence of exon 1c. The secretory path-ways of KLK11 isoforms appeared to differ, althoughboth isoforms were secreted from cells. Hence, the pro-moter use of the...
- 9
- 544
- 0
Báo cáo khoa học: PKA independent and cell type specific activation of the expression of caudal homeobox gene Cdx-2 by cyclic AM pptx
... in the endocrine cells from that in the nonendocrine intestinal epithelia. However, as the non-endocrine cell lines utilized in this study are cancerouscells of human origin, we employed the ... (1996) Cis-Acting elements and tran-scription factors involved in the intestinal specificexpression of the rat calbindin-D9K gene: binding of the intestine-specific transcription factor Cdx-2 to the TATA ... transcription factors and signaling mole-cules that regulate the expression of this promoter. Wefound that cotransfection of the Cdx-2 cDNA led toupregulation of the expression of the Cdx-2 gene promo-ter...
- 14
- 506
- 0
Báo cáo khoa học: Mitochondrial transcription factor A overexpression and base excision repair deficiency in the inner ear of rats with D-galactose-induced aging pdf
... animals [21,22]. These charac-teristics resemble those of the natural aging process inhumans and other animals. As the inner ear tissue is unacquirable during life in humans, and the geneticand ... account for the two copies of the b-actin gene in each cell nucleus. The mtDNA copy number of the control group was taken as the reference point tocalculate the relative mtDNA copy number of the ... the com-mon deletion. By applying the specific probe, we caneven detect the presence of the common deletion in the inner ear in the control group. The proportions of the common deletion in the...
- 11
- 450
- 0
Báo cáo khoa học: A transcription factor of lipid synthesis, sterol regulatory element-binding protein (SREBP)-1a causes G1 cell-cycle arrest after accumulation of cyclin-dependent kinase (cdk) inhibitors pdf
... range of genes involved in the synthesis of cholesterol, fattyacids, and phospholipids. All mammalian cells requirethese lipids for the duplication of membranes in celldivision. Depending on the ... have been established as transcription factors regulating the transcription of genes involvedin cholesterol and fatty acid synthesis [1,2]. SREBPproteins are initially bound to the rough endoplasmicreticulum ... together with the lipid-deprived medium,and Swiss-3T3 fibroblasts were treated with 100 lM oleate,followed by the MTT assay and cell-cycle analysis. For esti-mation of the nuclear form of SREBP-1...
- 13
- 541
- 0
Tài liệu Báo cáo khoa học: Epidermal growth factor receptor in relation to tumor development: EGFR-targeted anticancer therapy doc
... opening a new vista for genotype-directedtherapy in this disease.KRAS mutation as a mechanism of resistance to EGFR-targeted therapy The KRAS protein is localized to the inner surface of the cell ... result in the for- mation of lung adenocarcinomas, demonstrating thatexpression of these constitutively activated forms of EGFR is sufficient for transformation and required for maintenance of these ... amplifica-tion account for 70% of all known causes of acquired resistance to EGFR-TKIs in NSCLC, indi-cating that other mechanisms of resistance await dis-covery. It is therefore important to continue...
- 7
- 511
- 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
... mediates activation of Ras subsequent to the stimulation of Gi- and Gq-coupled receptors [8,9]. The main mechanism for the activation of Ras-GRF1 is the binding of Ca2+⁄ CaM to the N-terminalIQ ... physiological role of the guanine nucleotide exchange activity of the truncatedforms is not known as they are missing the Ca2+⁄CaM-binding IQ domain that is involved in the activa-tion of Ras-GRF1.Stimulation ... phosphorylation of both isoforms wasreduced by the coexpression of hPDE4D2 with 5-HT7receptors (Fig. 3C). This was also the case for ERK1 ⁄ 2phosphorylation (Fig. 3D).Phosphorylation of Ser916 is neither...
- 13
- 730
- 0
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx
... M oreover, the amount of cytochrome P450 aromatase, responsible for the irreversible transformation of androgens into estrogens, is decreased by b FGF at the transcriptional l evel. The bFGFinhibitory ... are m ainlyregulated at the transcriptional level. This report s hows that the b FGF r egulation of their expression speci®cally dependson the nature of HSPG and of the Sertoli cell developmentalstage.In ... (HSPG) on the cell surface [11].Oligosaccharidic sequences of HS chains are de®ned for the bFGF binding and for the recognition of the speci®c bFGFreceptor, leading to the formation of a ternary...
- 10
- 624
- 0
Báo cáo khoa học: Signal peptide hydrophobicity is critical for early stages in protein export by Bacillus subtilis ppt
... primer for construction of truncatedAmyQ variants for synthesis of nascent chainsamyQ95 GCCGGATCCTTCTCCTAAATCATACAA Amplification primer for construction of truncatedAmyQ variants for synthesis of ... around the filter, which can be visualized by staining of the plates with iodine vapor. The radius of the resultinghalos is indicative for the amounts of active a-amylasesecreted into the growth ... After 2 min of chase 53% of the AmyQwith the Leu signal peptide was processed to the mature form, whereas 71% of the AmyQ with the authentic signal peptide was processed within this time of chase....
- 14
- 282
- 0
Báo cáo khoa học: Active c-secretase is localized to detergent-resistant membranes in human brain pptx
... Lansbury PT Jr (1993) The car-boxy terminus of the b amyloid protein is critical for the seeding of amyloid formation: implications for the pathogenesis of Alzheimer’s disease. Biochemistry 32,4693–4697.5 ... explanations for the different results include choice of cell lines,whether the cells overexpress the proteins of interest,and the various detergents used for preparation of DRMs. As the majority of ... E (ApoE) is involved in cholesteroltransport, and the ApoE4 isoform is a risk factor for AD [16]. Thus, cholesterol seems to have an importantrole in APP processing and AD pathogenesis. Choles-terol...
- 14
- 330
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ