Báo cáo khoa học: Identification of the N-terminal region of TjZNT2, a Zrt⁄Irt-like protein family metal transporter, as a novel functional region involved in metal ion selectivity ppt
Báo cáo khoa học: Identification in the yeast Pichia stipitis of the first L-rhamnose-1-dehydrogenase gene docx
... Lane A contains the molecularmass markers (masses in kDa are indicated). Lane B contains the combined active fractions after the DEAE column separation.Lane C shows the protein eluted from the ... peptides of a protein with the GenBank identifier ABN68405. This protein had been annotated as a putative d-glucose-1-dehydro-genase II. The protein has 258 amino acids and a calculated molecular mass ... extract or a pro-tein preparation. The reaction was started by the addition of 10 mml-rhamnose or other sugars when specified. The formation of NADH was followed by measuring the absorbance at...
- 7
- 274
- 0
Báo cáo khoa học: Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) ppt
... 4991,E-mail: susan.douglas@nrc.caAbbreviations: AP-1, activator protein 1; ATF, activating transcriptionfactor-1; CAAT, CCAAT binding factor; C/EBP, CAAT/enhancerbinding protein; d.p.h., days ... noncoding strands, respectively. AP-1,activator protein 1; ATF, activating transcription factor-1; CAAT, CCAAT binding factor; GATA, GATA motif; a- IFN, a- interferon; NF-IL6,nuclear factor-interleukin ... (a Glu vs.an Asp at position 7 of the mature peptide) was used toestimate the activity of WF1-like pleurocidin.Antimicrobial assaysAll strains used in this study are listed in Table 3. As inhibition...
- 11
- 415
- 0
Báo cáo khoa học: Identification, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx
... eukaryotic kinases where binding of aninteracting protein removes the inhibitory conforma-tion of the activation loop of the kinase, leading to itsphosphorylation and further stabilizing the active ... [14], a transcriptional regulator participating in the control of peptide transport and sporulation initia-tion. All three proteins (MinD, SojA and SalA) lack a transmembrane activator protein in ... and in uences the kinase activity of the catalytic domain [4].McsB is a unique tyrosine kinase of Bacillus subtilisthat contains a eukaryotic-like guanidino-phospho-transferase domain for its kinase activity....
- 11
- 407
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... STAT protein inter-action domain, STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger domain, leucine-zipperdomain and fork-head domain ... GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 ... forZfstat6-F1 AGTGAGATGGATACAGGTGCTAAAC Initial PCRZfstat6-R1 TCTGGACCTCAGACATGAACTTACT Initial PCRZfstat6-F2 TGTCAGTCCTCTTTAATGCT Initial PCRZfstat6-R2 AATGGTATCCTGTTTGGCTCAG Initial PCRZf3¢stat6-F1...
- 20
- 689
- 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... detected. An alignment of these translated carbonic anhydrasecDNAs with vertebrate and nonvertebrate carbonic anhydrase protein sequences revealed the conservation of most amino acids involved in the catalytic ... zinc-containing enzymes catalyzing the reversible hydration of CO2to bicarbonate. Ubiqui-tous in a wide range of eukaryotic organisms, they arealso widespread in the Archaea and Bacteria domains[11]. ... the rough reticulum area around the nucleus and is maxi-mal in the cytoplasmic apex of the branchial epidermis.By contrast, the staining is very weak basally along the myoepithelium that lines...
- 14
- 591
- 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx
... GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM protein AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A ... GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor of kappa light polypeptide enhancer in B cells, kinasecomplex-associated protein AAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACAGGGATGGAGGGTAAGACCATACAGlutamine ... CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 CGTCCGATTTCTTCTCGTGTTTACCAGAAGACATTACAGTGAAAATTGAChaperonin-containing TCP1, subunit 7, isoform b, isoform 1 GGGAACCAGCAGTCGTCAAACGTCCACTGAGAGGATGAGACAInhibitor...
- 11
- 570
- 0
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... cm)1,at15°C. The gel was then dried and auto-radiographed. In the UV cross-linking assay, the samples were incuba-ted at room temperature, as described above for the EMSAassay, and then irradiated ... E. & Lavi, S. (1993) Replication protein A is the majorsingle-stranded DNA binding protein detected in mammalian cellextracts by gel retardation assays and UV cross-linking of longand ... GTsequence. Binding of the GT oligomer was not a result of DNA interaction with the more abundant components of the nuclear extract, as revealed by Ponceau staining of the immobilized proteins. In fact,...
- 12
- 552
- 0
Báo cáo khoa học: Identification of the amniotic fluid insulin-like growth factor binding protein-1 phosphorylation sites and propensity to proteolysis of the isoforms docx
... that the chargerepulsion between the phosphate groups in the mid- region and the one located in the C-terminal portion of the protein may cause a conformational change thatmakes the cleavage ... Journal compilation ª 2009 FEBS a mechanism for increasing the bioavailability of IGFsby enhancing the proteolytic cleavage as well as forproducing the C-terminal domain.We have examined the amino ... localconcentration of the amino acids proline, glutamic acid,serine, threonine, and, to a lesser extent, aspartic acid,are suitable targets for proteolytic degradation [29].Examination of the amino acid...
- 14
- 469
- 0
Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf
... seven mutations toabolish protein phosphorylation was a result of other protein kinases masking the PKA-catalysed part.Indeed, protein kinases other than PKA, includingtyrosine kinases, have been ... indicating that an additional, but weakdeterminant may be located distal to amino acid 411. Functional aspects of mutation of S385, S401 andT407 The effects of PKA-catalysed phosphorylation ... G -protein activated potassium channel; GST, glutathione S-transferase; PhB, phosphorylation buffer; PKA, protein kinase A; PKA-cs,catalytic subunit of PKA; PP 2A, protein phosphatase 2A. 6218...
- 9
- 403
- 0
Báo cáo khoa học: Identification of multiple isoforms of the cAMP-dependent protein kinase catalytic subunit in the bivalve mollusc Mytilus galloprovincialis potx
... Frac-tions of 0.5 mL were collected and assayed for protein kinase activ-ity. Three distinct peaks associated with protein kinase activitywere separated: I, II and III. Aliquots of fractions ... column and eluted with a linear saltgradient. Fractions of 0.5 mL were collected and assayed for pro-tein kinase activity. Two distinct peaks associated with protein kinase activity were separated: ... activity and determination of kinetic parametersC-subunit activity was assayed using the synthetic peptideKemptide (Sigma-Aldrich Quı´mica) as substrate. In a totalvolume of 50 lL, the assay contained...
- 11
- 509
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ