0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Trypanosoma brucei: a model micro-organism to study eukaryotic phospholipid biosynthesis docx

Báo cáo khoa học: Trypanosoma brucei: a model micro-organism to study eukaryotic phospholipid biosynthesis docx

Báo cáo khoa học: Trypanosoma brucei: a model micro-organism to study eukaryotic phospholipid biosynthesis docx

... M, Hashida-Okado T, Yasumoto R, Gomi K,Kato I & Takesako K (1999) An aureobasidin A resis-tance gene isolated from Aspergillus is a homolog ofyeast AUR1, a gene responsible for inositol ... and Molecular Medicine, University of Bern, SwitzerlandIntroduction Trypanosoma brucei is a eukaryotic protozoan parasitecausing African sleeping sickness in humans andnagana in domestic animals. ... notonly a devastating pathogen, affecting social and eco-nomic development in sub-Saharan Africa, but hasalso become an interesting model organism to study general biological processes. RNA editing...
  • 12
  • 391
  • 0
Báo cáo khóa học: Trypanosoma brucei oleate desaturase may use a cytochrome b5-like domain in another desaturase as an electron donor docx

Báo cáo khóa học: Trypanosoma brucei oleate desaturase may use a cytochrome b5-like domain in another desaturase as an electron donor docx

... A 1227 bp genomic clonewas obtained by PCR amplification with the forward primer5¢-CGGGATCCATGTTGCCTAAGCAACAGATG-3¢and the reverse primer 5¢-CCCAAGCTTAACTGCGAGTAATGCAGAT-3¢ containing BamHI ... degree and type of fatty acid desaturationbetween trypanosomes and their mammalian host, indicatethat fatty acid desaturases may be good targets fortrypanocidal drugs.Fatty acid desaturases are ... cyto-chrome; trypanosomatids.Trypanosomatids are parasitic protozoa that belong to the order Kinetoplastida. They are the causative agents ofseveral highly disabling and often fatal diseases occurring...
  • 8
  • 277
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Bayesian Network, a model for NLP?" ppt

... positivecases), but has a low recall (many false negativecases). Any sequence with a variation is ignoredby the automata and it is difficult to get exhaustiveadjective and verb semantic classes2. ... representation.3 A Bayesian Network Based SystemContainNo−ContainContain−Known−NounAnaphoric−ItNon−anaphoric−ItPronounStarNo−StartStart−PropositionStartNo−StartStart−SentenceStartNo−StartStart−AbstractNo−matchMatchLeft−Context−ConstraintsContainNo−ContainContain−Known−AdjectiveMatchNo−matchSuperior−eleven ... threeInferior−threeContainNo−ContainMoreThreeTwoOneOtherPrepositionObjectSubjectGrammatical−RoleMatchNo−match To ThatWhether−ifWhich−WhoOtherSequence−LengthLCR−AutomataContain−Known−VerbHCR−AutomataUnknown−WordsDelimitorFigure 1: A Bayesian Network for...
  • 4
  • 388
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Discourse Relations: A Structural and Presuppositional Account Using Lexicalised TAG*" docx

... syntax and semantics and that of the clause. References Nicholas Asher and Alex Lascarides. 1999. The semantics and pragmatics of presupposition. Journal of Semantics, to appear. Dan Cristea ... (2c) are the assertions that the situation associated with B is a cause for that associated with A and that the situ- ation associated with B is one of a set of such causes. Finally, Example ... current approach, Asher and Las- carides (1999) take all connections (of both as- serted and presupposed material) to be struc- tural attachments through rhetorical relations. The relevant rhetorical...
  • 8
  • 415
  • 0
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

... 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGTGAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGTAGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAAGCCGTTGTAGTTTTTGGTGAATCTT-3¢; C126M, 5¢-TAATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢;and ... site-specificmutagenesis – distal effects on dimer stabilityMoumita Samanta1, Mousumi Banerjee1, Mathur R. N. Murthy1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian ... the crystals. X-ray diffraction datawere collected with a Rigaku rotating anode generator and a MAR Research image plate detector system. The datawere processed with mosflm and scala [31] of...
  • 12
  • 393
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Co-dispersion: A Windowless Approach to Lexical Association" ppt

... disciplines as multi-scalar analysis, of which fractal analysis is a variant. Although a certain amount has been written about the fractal or hierarchical nature of language, approaches to co-occurrence ... generate a probabilistic language model, where previously n-gram models have been used, The allusion to proximity as a fundamental indicator of lexical association does in fact per-863meate ... Hardcastle (2005) and Washtell (2007) apply this same concept to measuring word pair associations, the former via a somewhat ad-hoc approach, the latter through an extension of Clark-Evans...
  • 9
  • 237
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "The Contribution of Linguistic Features to Automatic Machine Translation Evaluation" docx

... the table we have also included a ran-dom, a maximum (always pick the best transla-tion according to humans) and a minimum (al-ways pick the worse translation according to hu-man) OST for all4. ... met-ric variants at three linguistic levels: lexical, syn-tactic, and semantic. In all cases, translation qual-ity is measured by comparing automatic transla-tions against a set of human references.At ... scored translations5.2.1 Analysis of Evaluation SamplesIn order to shed some light on the reasons for theautomatic evaluation failures when assigning lowscores, we have manually analyzed cases...
  • 9
  • 514
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Exploiting Web-Derived Selectional Preference to Improve Statistical Dependency Parsing" docx

... self-training for parser adaptation. InProceedings of ACL.D. McClosky, E. Charniak, and M. Johnson. 2010. Au-tomatic Domain Adapatation for Parsing. In Proceed-ings of NAACL-HLT.R. McDonald and ... largestdata set that is available for NLP (Keller and Lap-ata, 2003). Another is a web-scale N-gram corpus,which is a N-gram corpus with N-grams of length 1-5 (Brants and Franz, 2006), we call ... selectional preference features derived fromBritish National Corpus (Graff, 2003) into a stochas-tic unification-based grammar. Abekawa and Oku-mura (2006) improved Japanese dependency pars-ing...
  • 10
  • 253
  • 0
Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx

Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx

... GTCGACCTGCAGCCCAAGCTTGCGTTGCTG A- flap ATGTGGAAAATCTCTAGCAGGCTGCAGGTCGACB-flap CAGCAACGCAAGCTTGATGTGGAAAATCTCTAGCAB-g1 CAGCAACGCAAGCTTB-g2 CAGCAACGCAAGCTB-g4 CAGCAACGCAAG A- b15 AGAGATTTTCCACAT A- b17 CTAGAGATTTTCCACAT A- b19 ... CGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTCX3 GACGTCATAGACGATTACATTGCTAGGACATGCTGTCTAGAGACTATCGCX4 GCGATAGTCTCTAGACAGCATGTCCTAGCAAGCCAGAATTCGGCAGCGTCX1half GGACATCTTTGCCCACGTTGACCCGX1half-g4 ATCTTTGCCCACGTTGACCCGX1half-g8 TTGCCCACGTTGACCCGX4half ... CGGTCAACGTGGGCATACAACGTGGCACTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGTCCTAGCAAAGCGTATGTGATCACTGGX1 GACGCTGCCGAATTCTGGCTTGCTAGGACATCTTTGCCCACGTTGACCCGX2 CGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTCX3...
  • 14
  • 433
  • 0
Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

... NAD+k5[ACA] [NADH]ATPase: ATP fi ADP k6[ATP]storage: Glc + 2 ATP fi 2 ADP k7[Glc] [ATP]glycerol: trioseP + NADH fi NAD+k8[trioseP] [NADH]difACA: ACA Ð ACAxk9([ACA] ) [ACAx])outACA: ACAxfi ... by means of mathematicalmodels with varying degrees of detail. A primaryadvantage of a detailed, biochemically formulated model is that a one -to- one comparison can be madebetween model and ... results. Addi-tional information is available in the Supplementarymaterial.The mathematical models described here have beensubmitted to the Online Cellular Systems ModellingDatabase and can be accessed...
  • 16
  • 492
  • 0

Xem thêm

Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ