Báo cáo khoa học: "BULK PROCESSING OF TEXT ON A MASSIVELY PARALLEL COMPUTER" docx

... memory and processor limitations. 8.1 Parallel Sorting A parallel sort is similar in function to a serial sort. It accepts as arguments a parallel data field and a parallel comparison predicate, ... variables are called parallel variables, or parallel fields. When a host computer program per- forms a serial operation on a parallel variable, that operation is performed separately in each ... BULK PROCESSING OF TEXT ON A MASSIVELY PARALLEL COMPUTER Gary W. Sabot Thinking Machines Corporation 245 First St. Cambridge~ MA 02142 Abstract Dictionary lookup is a computational activity...

Báo cáo khoa học: Autocatalytic processing of procathepsin B is triggered by proenzyme activity doc

... 5¢-CCAGAACGTTATGTTTGCAGCTGCACTGAAGCTGCCTGC-3¢(for the TED58AAA mutant: R54N, T5 8A, E5 9A, D6 0A) ;5¢-CCCAGAACGTTATGGCTGCAGCTGCACTGAAGCTGCCTG-3¢ (for the FTED57AAAA mutant: R54N,F5 7A, T5 8A, E5 9A, ... 5¢-CCAGAACGTTATGTTTGCACTGAAGCTGCCTGC-3¢ (for the T58ADEDmutant: R54N, T5 8A, deletion of E59 and D60); 5¢-GAACGTTATGTTTACCGCAGCTCTGAAGCTGCCTGC-3¢(for the ED59AA mutant: R54N, E5 9A, D6 0A) ; 5¢-CCAGAACGTTATGTTTGCAGCTGCACTGAAGCTGCCTGC-3¢(for ... E5 9A, D6 0A) ; 5¢-CCAGAACGTTATGGCTACCGAGGACCTGAAGC-3¢ (for the F5 7A mutant:R54N, F5 7A) ; 5¢-CCAGAACGTT(GC)CGTTTACCGAGG-3¢ (a degenerate primer for M5 6A and M56P mutants;R54N, M5 6A and R54N,...

Báo cáo khoa học: "Diagnostic Processing of Japanese for Computer-Assisted Second Language Learning" doc

... JAPAN{kakegawa,kanda,eitaro76,itami,itoh}@itlb.te.noda.sut.ac.jpAbstractAs an application of NLP tocomputer-assisted language learn-ing(CALL) , we propose a diag-nostic processing of Japanese ... dependencygrammar ”(M.Nagao, 1996).2 LTAG of Japanese2.1 The Characteristic of JapaneseJapanese phrases are classiﬁed in theﬁrst place into two categories: Yougenphrase(YP) and Taigen phrase(TP). A ... for Diagnosis and Dialogue DatabaseRetrieval in a Learning Environment forJapanese as Second Language ”, Proceedings of AIED ’97, pp.247-254.Diagnostic Processing of Japanese forComputer-Assisted...

Báo cáo khoa học: "Discourse Processing of Dialogues with Multiple Threads" pot

... information in machine translation. In (Iida and Arita 1990; Kogura et al. 1990), researchers at ATR advocate an approach to machine translation called illocutionary act based translation, argu- ... State-Constraint. And any State-Constraint can attach to the active path as a confirmation because the constraints on confirmation attachments are very weak. Since State-Constraint is weaker than Accept, ... action would become a child. If an action on the active path is a repeat- ing action, rather than only the rightmost instance being included on the active path, all adjacent in- stances of...

Báo cáo khoa học: "EFFICIENT PROCESSING OF FLEXIBLE CATEGORIAL GRAMMAR" potx

... Throughout this paper we will be us- ing the notation of Lambek (1958), in which A/ B and B \A are a right-directional and a (i) application : A/ B B ==> A B B \A ==> A composition: A/ B B/C ... generative grammar is that coordination always takes place between between constituents. Right- node raising constructions and other in- stances of non-constituent conjunction are problematic, ... something like concatenation, but whereas such operations are normally asso- ciated with particular grammatical rules (i.e. you may concatenate two elements of category N P and V P, respectively,...

Báo cáo khoa học: "Automatic Detection of Text Genre" doc

... cost of training on a large set of cues. Variation measures capture the amount of variation of a certain count cue in a text (e.g the stan- dard deviation in sentence length). This type of ... genres as bundles of facets, we can categorize this genre as INSTITUTIONAL (because of the use of we as in edi- torials and annual reports) and as NON-SUASIVE or non-argumentative (because of ... surface variables. 5 Discussion The experiments indicate that categorization deci- sions can be made with reasonable accuracy on the basis of surface cues. All of the facet level assign-...

Báo cáo khoa học: "VARIOUS REPRESENTATIONS OF TEXT PROPOSED FOR EUROTRA" docx

... a human partner. In this table, we also indicate the alphabetical order of each Language. Each Language has its own characteristics ; in French, for example, dictionaries are sorted according ... sublanguage. Hence, a "title" format may be used by the analyzer to use an appropriate subgramma~ - how alphabetical transcriptions are carried out. No coding standards exist for all ... the context of M (A) T, th~ advantages of taking into account the structure of the text are twofold : - the text can be decomposed if only part of it is to be translated ; - it is easy to...

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... 4919Proteomic analysis of dopamine and a- synuclein interplayin a cellular model of Parkinson’s disease pathogenesisTiziana Alberio1, Alessandra Maria Bossi2, Alberto Milli2, Elisa Parma1, Marzia ... neu-rons of the substantia nigra pars compacta (SNpc) anddepletion of striatal dopamine. Dopaminergic neuronaldeath is accompanied by the appearance of Lewybodies (LB), intracytoplasmic inclusions ... plasmid containing human a- synuclein cDNA (a- syn). As a control, we usedSH-SY5Y cells stably transfected with the plasmidcontaining b-galactosidase cDNA (b-gal). Western blotanalysis revealed...

Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

... Ivanova N, Sorokin A, Anderson I, Galleron N,Candelon B, Kapatral V, Bhattacharyya A, Reznik G,Mikhailova N, Lapidus A et al. (2003) Genomesequence of Bacillus cereus and comparative analysiswith ... allowed regions of a Ramachandran plot. Asp14 isthe only BcZBP residue that adopts an energeticallyunfavorable main chain conformation through which a close approach of the side chain to the active ... date [12] which are based either on a single, bifunc-tional GAB catalyst or on a GAB catalysts pair. Theavailable biochemical data on MshB and LpxC are notsufﬁcient to unambiguously identify...

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherﬁsh Misgurnus fossilis Functional consequences for the enzyme ppt

... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R)12 reverse CAAGGAGCGTTAGAATCTAAAG H1R13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R)14 reverse GATTTAAGTGGAGCGGAATGCTA ... reverse ACGAAACCTGGCAGAGTCCAAG B6R5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R7 both forward CAGAAAAAGACAAGGAGGAC F19RIsoform-speciﬁc ... 8 both forward ACAACACCACTGCTGCGGAGTTA J1F9 short reverse ACATCAAGGAGCGTTAGAATCTAA J2R 1201 (with J1F and J2R)10 long reverse GATTTAAGTGGAGCGGAATGCTA J3R 1385 (with J1F and J3R)Real time PCR...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP