Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-speciﬁc polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Structural and serological studies on a new 4-deoxy-D-arabino-hexose-containing O-speciﬁc polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) Ewa Katzenellenbogen1, ... (C) of the lipopolysaccharide (LPS)-I (lane 1) and LPS-II (lane 2) of C. braakii PCM 1531, LPS of Citrobacter PCM 1504 (lane 3), LPS of Citrobacter PCM 1505 (lane 4) and LPS of Citrobacter PCM 1487 ... immunodiﬀusion of anti- (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and LPS-II(well 2) of C. braakii PCM 1531, and LPSof...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... b-strands,six a- helices and three 310-helices. The core of the pro-tein is made up of a nine-stranded b-sheet ﬂanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1Structure of Salmonella ... templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) ... Billerica, MA, USA).Initial characterization of the protein The purity and molecular mass of the protein were checkedby 12% SDS ⁄ PAGE and MALDI-TOF MS. Gel-permeationchromatography with 200 lLofa1mgÆmL)1protein...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... with the exception that sonicationwas used instead of high pressure homogenization, the puriﬁcation was conducted on an A ¨KTAxpress system(GE Healthcare).Crystallization, data collection and ... nucleotidebeing added to crystallization solutions. The ligandbound was interpreted as GMP because the N2 of the base makes a hydrogen bond to a main chain car-bonyl. Binding of a xanthine base from XMP ... Canyuk B, Focia PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and...

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 000 A ˚2) as con-tact area. Thus, a large amount of the available surfacearea of the molecule is buried upon pentamerization,increasing the stability of the protein. The hAd2 ⁄ 12 penton base ... base, [LigB] is the concentration of the bound ligand (miniﬁber), and [Ligtot] is the total con-centration of the ligand. At any total concentration of lig- and, the anisotropy depends on ... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cyssequence was introduced at the C-terminus...

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... tract, gills, heart and labial palp) including female gonads (oocytes), and from various stages of embryonic and larval devel-opment (blastula, gastrula, trochophore larvae, D lar-vae, 7 and ... insynapse regulation and ⁄ or maintenance [15,16].As part of an ongoing project to understand the role of the TGF-b superfamily ligands, their receptors and signal transduction pathways in the ... algorithm for each node.Isolation and characterization of Cg-BMPR1 and Cg-TGFbsfR2 TGFb genes A C. gigas genomic library was constructed in kDASH II(Stratagene, La Jolla, CA, USA). A total of 1.8 ·...

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... conformationalspace of b-aminoacidsislargerthanthatofa-aminoacids, but low-energy conformations of the b-amino acidsbackbone, corresponding to gauche rotamers around the Ca–Cb bond, can overlap canonical ... conventional techniques [37]. The chemical shifts of a carbon (Ca) have been assigned from HSQC spectra (data not shown). The chemical shiftdeviations of Ha protons and Ca carbons (CSDHa and CSDCa), ... Curie, Paris, FranceMolecular mechanics calculations on conformers of Ac-HGly-NHMe, Ac-b2-HAla-NHMe and Ac-b3-HAla-NHMe indicate that low-energy conformations of the b-amino acids backbone,...

Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new afﬁnity label for probing the structure and function of glutathione transferases potx

... represents the fractional residual activity of the partial active enzyme intermediate, and kfast and ksloware the rate constants for the slow a nd fast phase of the reaction.Analysis was performed ... binds at one site at all stages of the reaction. The best explanation for these results maybe that the reaction of SDTG at the binding site of onesubunit changes the conformation of the o ther ... kd=ðk3½SDTGÞwhere kobsis the rate of enzyme inactivation for a givenconcentration of S DTG, k3isthemaximalrateofinacti-vation (min)1), and Kdis the apparent dissociation constant of the E :SDTG complex....

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: electron transfer through the nitric oxide synthase ﬂavoprotein domain pdf

... 50 and near 100%) [63,77]. At this point, the data suggestthat Keq A and the associated k on and koffconforma-tional rates are primary factors in regulating the cyto-chrome c reductase activity ... domain has fundamen-tal structural, thermodynamic and mechanistic featuresin common with the dual-ﬂavin family of reductases,there are unique aspects related to NO synthesis thatconstrain and ... roles of CaM, the CT and bound NADPH have been studiedin detail. An interesting and possibly novel connectionappears to link regulation of Keq A by the CT and Table 1. Factors that may alter conformational...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: probes of hydrogen tunnelling pptx

... reduction during the reaction of the wild-type (wt) and N18 9A mutant of MR withNADH. The wt trace is ﬁt to a single exponential and the N18 9A trace to a 4-exponential function – see the main text ... substrate-binding titrations and crystallo-graphic studies when a very large amount of the sub-strate may be required; typical NAD(P)H saturationconstants for OYEs are 0.1-1 mm and as an example, a ... microscopic reaction barrier,but rather reduces the average barrier width, the macro-scopic barrier, by restricting the conformational spaceavailable to the NADH and FMN moieties within the active...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... in favour of a stronger H-bond between the carbonyl of N58 (‘O-up’ conformation) and FMNN(5)H [41]. The semiquinone states of A. nidulans and Anabaena Flds are less stable than those from otherspecies ... both of the large PSI subunits,PsaA and PsaB, via a loop that also plays a role in the attachment of PsaC [12]. PsaC, PsaD and PsaE arelocated at the cytosolic site (Fig. 1A) [2,7,13–16]. PsaCcarries ... required. Mutational and structural studies that characterize such interac-tions are the subject of this minireview. Studies on proteins from the cyanobacterium Anabaena are pref-erentially considered...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ