Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc
Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc
... Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging Elke Fordel, Liesbet Thijs, Luc Moens and Sylvia DewildeDepartment of ... the finding ofincreased hypoxia-inducible factor (HIF)- 1a and up-regulation of Cygb mRNA, and hypothesized thatCygb (and Ngb) may have a vital role in retinal oxy-gen homeostasis, enabling the ... H2O2levels. For brain and eyes,there was a gradual increase in the amount of H2O2after hypoxia and reoxygenation. In heart, muscle and liver, the H2O2level dropped after 24 h of reoxygena-tion....
- 6
- 391
- 0
Báo cáo khoa học: Cdc37 maintains cellular viability in Schizosaccharomyces pombe independently of interactions with heat-shock protein 90 doc
... thepostulated heat-shock protein (Hsp) 90-binding and homodimerizationdomains, can also sustain cellular viability, indicating that Cdc37 dimeriza-tion and interactions with the cochaperone Hsp90 may ... overnight in MM containing adenine and uracil. The attenuance at 600 nm was adjusted to 0.5 and serial dilutions were spotted onto MM + adenine +uracil plates with and without 5¢ fluoro-2¢-deoxyuridine(5FOA). ... discovered that expression ofthe N-terminal domain alone can sustain cellular via-bility. These truncated proteins do not contain the pos-tulated Hsp90-binding domain, suggesting that bindingof...
- 12
- 275
- 0
Báo cáo khoa học: The first cytochrome P450 in ferns Evidence for its involvement in phytoecdysteroid biosynthesis in Polypodium vulgare doc
... Educacio´nyCiencia (Spain) projects AGL2001-2285 and AGL2004-05252 is acknowledged. DC thanks Generalitatde Catalunya for a predoctoral fellowship. The authorsalso thank G. Fabrias for critically reading ... ratio was analysed after 24 husing HPLC. (C) Untreated calli. The biotransformation ratio wasnormalized to untreated calli, assigned a relative activity of 1. A, aminoglutethimide; M, miconazole; ... calli. This dose wascompared with several plant P450 inhibitors on thesame reaction calli. Control calli, and P450 inhibitor-treated calli, were treated with E and after 24 h thetransformation...
- 9
- 247
- 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
... A5 1 (5¢-GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7(5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢-AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8(5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); thirdset, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATGCAG-3¢)/TRHR-9 ... amplified as described above usingpartially overlapping cDNA fragments and the pair ofprimers TRHR1-2 sense (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TCTGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2sense ... xTRHRs in the brain, liver, testis, urinary bladder, stomach, ventral and dorsal skin, lung, heart and intestine were also examined.No signal was obtained by Northern blotting, probablybecause...
- 11
- 506
- 0
Báo cáo khoa học: High and complementary expression patterns of alcohol and aldehyde dehydrogenases in the gastrointestinal tract Implications for Parkinson’s disease docx
... Schematic drawings of the stomach (A) , small (B) and large(C) intestinal walls. The figure shows the localization of Adh1,Adh3, Adh4 and Aldh1 mRNA expression in the rat (R) and mouse(M) gastrointestinal ... with a role in a defense system, protecting against alcohols, aldehydes and formalde-hydes as well as being involved in retinoid metabolism.AbbreviationsADH, alcohol dehydrogenase; ALDH, aldehyde ... nervoussystem in PD and found that both Meissner’s and Auerbach’s plexuses were affected already in early sta-ges of disease and terminal axons of postganglionic and preganglionic neurons contained a- synuclein-posi-tive...
- 12
- 504
- 0
Báo cáo khoa học: Stage-specific expression of Caenorhabditis elegans ribonuclease H1 enzymes with different substrate specificities and bivalent cation requirements ppt
... 10111213141516 A 5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'5'-GCGAAUUUAGGGCGAgagcaaacttctcta-3'Ce-RNH1α, Ce-RNH1βCe-RNH 1A Ec-RNHIPf-RNHIICB3'5'Ce-RNH1α ... obtained in at least two inde-pendent experiments for each gene.rnh-1.0αrnh-1.0βαβ A UGAAAAUUUAGGAGUCAAACGUUGUUUUAGAUUCAAGAAAαβBFig. 3. Alternative splicing of rnh-1. 0a and rnh-1.0b. (A) Schematicpresentation ... were analyzed by SDS ⁄ PAGE on a 10–20% gradi-ent gel and stained with Quick-CBB (Wako, Osaka,Japan). In vitro assay for RNase H activityRNase H activity was assayed by analyzing the stability...
- 10
- 385
- 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx
... thesame as in abrin and ricin A- chains. This suggests thatthe catalytic reaction is exactly the same. The sugarbinding pulchellin B-chains are 264 (P I and P II) or263 (P III and P IV) amino acids ... galactose and galactose-containing structures, can agglutinatehuman and rabbit erythrocytes, and kills mice and themicrocrustacean Artemia salina at very low concentra-tions [10]. Similar to the ... described above.Hemagglutination and hemagglutination-inhibition assaysHemagglutination assays were carried out using normalhuman (A +,B+ and O+), horse and rabbit erythrocytes in P. V. Castilho...
- 12
- 763
- 0
Tài liệu Báo cáo khoa học: "Structural and Topical Dimensions in Multi-Task Patent Translation" ppt
... onComputational Linguistics (COLING’10), Beijing,China.Alexandru Ceaus¸u, John Tinsley, Jian Zhang, and Andy Way. 2011. Experiments on domain adap-tation for patent machine translation in the ... Ueffing, Gholamreza Haffari, and AnoopSarkar. 2007. Transductive learning for statisticalmachine translation. In Proceedings of the 45th An-nual Meeting of the Association of ComputationalLinguistics ... error rate training for patent translation.3 Extraction of a parallel patent corpusfrom comparable dataOur work on patent translation is based on theMAREC3patent data corpus. MAREC con-tains...
- 11
- 436
- 0
Báo cáo khoa học: Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus doc
... deletions in cag-negative strains, rearrangements include an inversionof cagQ, a duplication of cagA and cagB associated with cagA degeneration, and a more complex rearrangement comprising all cag ... from Ameri-can Indians have a duplication of cagA (in a nonfunctional form) and cagB inserted into the inter-genic locus between cagP and cagQ [14] (Fig. 1B).Additionally, these islands have an ... [22,33]. Interestingly, the interactionbetween CagT and CagX was lost in a cagM mutant,indicating that it is either an indirect interaction viaCagM, or that only a ternary complex comprising allthree...
- 10
- 393
- 0
Báo cáo khoa học: "Methods and Practical Issues in Evaluating Alignment Techniques" doc
... of the alignment level. Assuming the alignment A = {al, a2 , , am} and the reference Ar = {arl, at2, , am}, with ai = (asi, ati) and arj = (arsj,artj), we can derive the following sentence-to-sentence ... to align, since it contains 94% of 1-1 align- ments, reflecting a translation strategy based on speed and absolute fidelity. In addition, this corpus contains a large amount of data that remains ... Identifying and Translating Techni- cal Terminology. In Proceedings of ANLP-94, Stuttgart, Germany. • F. D~bili, E. Sammouda, and A. Zribi. 1994. De l'appariement des roots ~ la comparaison...
- 7
- 400
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ