Báo cáo khoa học:The isolation and characterization of temperature-dependent ricin A chain molecules in Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

... and 4) high molecular mass bands of approximately 110 kDa and > 200 kDa were visible, as well as a faint band at37 kDa, suggesting the presence of dimers. All of the bandsstained positively ... intenseband of 61 kDa (NrfA) and a band of weak intensity of 19 kDa (NrfH), conﬁrming its hetero-oligomeric nature(Fig. 1, lane 1).However, in the absence of boiling (Fig. 1A, lanes 2 and 4) ... compriseCytc_DdesCytc_DgigNrfH_WsucNrfH_SdelNrfH_DdesCymA_SputNapC_RsphNapC_PpanNapC_AbraNapC_Paer VDAPADMV.IKAPAGAKVTKAPV AFSHKGHASM VDVPADGAKIDFIAGGE.KNLTV VFNHSTHKDV MNKSKFLVYSSLVVFAI ALGLFVYLVNASKALSYLSSDPKACI NCHVM. NPQYAT MKNSNFLKYAALGAFIVAIGFFVYMLNASKALSYLSSDPKACI...

Báo cáo khoa học:The isolation and characterization of temperature-dependent ricin A chain molecules in Saccharomyces cerevisiae docx

... target cells and the fate of its two subunits,RTA and the cell-binding galactose-specific lectin ricin toxin B chain (RTB), are essential to gain furtherinsights into the mechanism of toxin action ... CP133 5¢-TTAAAACTGTGACGATGGTGGA-3¢ with the TAA termination anticodon shown in bold. Amplification reactions were performed in a final vol-ume of 50 lL containing 5 ng of template DNA accordingto ... mutantsFEBS Journal 274 (2007) 5586–5599 ª 2007 The Authors Journal compilation ª 2007 FEBS 5599The isolation and characterization of temperature-dependent ricin A chain molecules in Saccharomyces...

Báo cáo khoa học: Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae docx

... 0.81ATcAAACA 0.03cATtAAACA 0.01cATGcAACA 0.69ATGgAACA 0.20cI ATGAgACA 0.02cATGAAgCA 0.05cATGAAAgA 0.30III ATGAAACg 0.26 a PREs represented in the FUS1 promoter (Fig. 4B).bRCS for eacholigo ... signiﬁcantTable 1. RCS of mutant PREs for binding of wild-type Ste12 to a PRE consensus (ATGAAACA) in vitro.FUS1 PRE a Sequence RCSbII ATGAAACA 1.00IV tTGAAACA 0.27cAaGAAACA 0.14ATaAAACA 0.81ATcAAACA ... single PRE in vitro.This indicates that either the activation domain of Ste12 is incapable of activating transcription whenbound to a single site, or that binding to a single siteOrganization...

Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc

... GTCGTAATTAATCACTTAACCGTGCTCGCYP71 9A2 reverse GAAAGAAACAGAGCAAATCTTATCCTTTTACCCYP71 9A3 forward CCTCGTAACTAATATACCAGTGTGGTGCYP71 9A3 reverse GACAACCAAGCAAACTCTTATTCTTGTACInternal control geneb-actin ... reverse CAATGGAGTTGGTGGGTGAABBE forward GAGATTAGTAGGAGTTGGGGTGAGABBE reverse ATTGGAGGGATACTTTGTGGATG4’-OMT forward CCTAGAAGAGGAATCAGAACATCCA4’-OMT reverse TCACTTCTCTCCCTTCCACCACYP71 9A2 forward ... primer(5¢-ATACTAGTGCACGGTTAAGTGATTAATTACG-3¢)for CYP71 9A2 , and the forward primer (5¢-ATACTAGTATGGAGGAGATGAAGTTCTTGATAATG-3¢)andreverseprimer (5¢-ATACTAGTTATTAGTTACGAGGATTGATTCGAGC-3¢) for CYP71 9A3 .PCR products...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

... 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT ... GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial PCRZffoxp3-F2 TGCCACCTTTTCCATCATACA Initial PCRZffoxp3-R2 CTGCTTTTCTGGGGACTTCA Initial ... vertebrates.Signiﬁcant homology was seen in the putative T-boxDNA-binding domain of t-bet, the STAT protein inter-action domain, STAT protein all-alpha domain, STATprotein DNA-binding domain and SH2 domain of stat6,...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a sialic acid speciﬁc lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... Bovine submaxillary mucin,which contains mainly 9-O-acetyl- and 8,9 di-O-acety-N-acetyl neuraminic acid was the most potent inhibitor of thelectin. Sialidase treatment and de-O-acetylation of ... lectin on SDS/PAGE gave a singleband at apparent molecular mass of 34 kDa.The binding afﬁnity of the lectin in the hemolymph of the freshwater crab, Paratelphusa jacquemontii, expressedO-acetyl ... lectins in crab may recognize and bind to such organisms that contain sialic acid [12]. Lectinshave the ability to agglutinate bacteria [56,57], interact withmicroorganisms [58] and enhance phagocytosis...

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulﬁde reductase from methanogenic archaea pdf

... members, including AF499,have an N-terminal Ôtwin-arginineÕ signal sequence that ischaracteristic of cofactor-containing proteins translocatedinto the periplasm via the Tat translocase [27]. As ... with anapparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1).Table 1. N-Terminal sequences of the polypeptides of the puriﬁed enzyme. N-Terminal sequen ... and AF501 overlap by 3 bp). The region 81–65 bp upstream of t he start c odon of AF499 was identiﬁed asan archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a...

Báo cáo khoa học: Puriﬁcation and characterization of zebraﬁsh hatching enzyme – an evolutionary aspect of the mechanism of egg envelope digestion pot

... using a sense primer, 5¢-CATATGAATGCTCTCATCTG CGAGGACA-3¢, containing a 5¢ NdeI site and start methionine resi-due, and an antisense primer, 5¢-GGATCCTAGTGATGGTGATGGTGGCATCCATACAGCTTATTGATCC-3¢,which ... forward: 5¢-CTGAACTTCTCTACACACTGAGG-3¢, reverse: 5¢-CCTTATCACCATCACCTCACTTC-3¢; ZHE2 forward: 5¢-CTCCACACACTGAGACTAAATGG-3¢, reverse: 5¢-GGAAATAAGAGCACGTACTGTGG-3¢.The cycle number of PCR was ... orMLCE, and their SDS ⁄ PAGE patterns were com-pared. SDS ⁄ PAGE of the MHCE digest after a 10 and 40 min incubation gave two bands (43 and 39 kDa), and an additional band (36.5 kDa) was observed aftera...

Báo cáo khoa học: Identiﬁcation and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... gene assay in in vivo results.Experimental proceduresParasitesThe NMRI strain of S. mansoni was maintained in snails(Biomphalaria glabrata) and Syrian golden hamsters(Mesocricetus auratus ... motifs binding to the cis-regulatory region of a target gene, and a conserved ligand-binding domain(LBD) that is involved in transcriptional activation of the target gene via ligand and coregulator ... from agarose gelusing Gel Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with32P using a Metaprime kit (Amer-sham Pharmacia Biotech Inc., Piscataway, NJ, USA). ForBAC DNA sequencing,...

Báo cáo khoa học: Puriﬁcation and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt

... proteinases it can be deduced that the commonancestor of the genera Carica and Vasconcelleaalready contained at least two different cysteine pro-teinases in its latex (papain and chymopapain). ... translation showed that they holdthe characteristic features of all known papain-class cysteine proteinases, and a phylogenetic analysis revealed the existence of several papain and chymopapain ... microhet-erogeneity in the N-terminal and cDNA sequences reveals the presence of several distinct cysteine proteinase isoforms in the latex of Vasconcellea spp.AbbreviationsAA, amino acid; BAPNA, a- N-benzoyl-L-arginine...

Xem thêm